| Variant ID: vg1217492814 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17492814 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )
AAGTGAGAAGAGGAGCTCCTTTTATAGGCAGGTAATGACGGTTGTGACGGTTGGAATGGTTGGTAATACCCTCCAACCGTCATTGGGGATCAATCCCAGC[T/C]
ATCCATCCAAACCCTGCATCCATCGGTGCCACGGGAGGTTCGGCCGAACCCTATGGTTCGGCCGAACCATGGGCTGGCCCAACCCAGCCCATCTTCGGCT
AGCCGAAGATGGGCTGGGTTGGGCCAGCCCATGGTTCGGCCGAACCATAGGGTTCGGCCGAACCTCCCGTGGCACCGATGGATGCAGGGTTTGGATGGAT[A/G]
GCTGGGATTGATCCCCAATGACGGTTGGAGGGTATTACCAACCATTCCAACCGTCACAACCGTCATTACCTGCCTATAAAAGGAGCTCCTCTTCTCACTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 18.10% | 0.11% | 3.72% | NA |
| All Indica | 2759 | 95.90% | 1.70% | 0.14% | 2.28% | NA |
| All Japonica | 1512 | 49.30% | 43.30% | 0.07% | 7.28% | NA |
| Aus | 269 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.80% | 1.00% | 0.50% | 7.73% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 94.70% | 3.20% | 0.13% | 2.04% | NA |
| Temperate Japonica | 767 | 10.00% | 77.20% | 0.13% | 12.65% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.70% | 24.90% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 20.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217492814 | T -> C | LOC_Os12g29440.1 | upstream_gene_variant ; 1992.0bp to feature; MODIFIER | silent_mutation | Average:41.243; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1217492814 | T -> C | LOC_Os12g29450.1 | downstream_gene_variant ; 4209.0bp to feature; MODIFIER | silent_mutation | Average:41.243; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1217492814 | T -> C | LOC_Os12g29440-LOC_Os12g29450 | intergenic_region ; MODIFIER | silent_mutation | Average:41.243; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1217492814 | T -> DEL | N | N | silent_mutation | Average:41.243; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217492814 | NA | 7.03E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1217492814 | NA | 4.44E-17 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1217492814 | NA | 2.04E-14 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1217492814 | NA | 2.82E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217492814 | NA | 5.07E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217492814 | NA | 1.14E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217492814 | NA | 6.44E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217492814 | NA | 5.48E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217492814 | NA | 8.69E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217492814 | NA | 2.97E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/