\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217468587:

Variant ID: vg1217468587 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17468587
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACTCGATTTAGACCGAGGACCGAACCGAACTATCGGTTAACCGATCTGTCGGTCAGTACTCTTCTATAGGTGAGTTCGGTTTCCTTTTCTCAAAGACC[G/A]
ATCTTTTTAAAGACCGAATTAACCGGACCGACCTTTCGGTCTACACCGAATACGCACCACTAGCTGTTCCATTCCCTCTATTTTGGGCCATCGGTCCGCC

Reverse complement sequence

GGCGGACCGATGGCCCAAAATAGAGGGAATGGAACAGCTAGTGGTGCGTATTCGGTGTAGACCGAAAGGTCGGTCCGGTTAATTCGGTCTTTAAAAAGAT[C/T]
GGTCTTTGAGAAAAGGAAACCGAACTCACCTATAGAAGAGTACTGACCGACAGATCGGTTAACCGATAGTTCGGTTCGGTCCTCGGTCTAAATCGAGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.90% 30.00% 0.04% 0.00% NA
All Indica  2759 62.80% 37.20% 0.07% 0.00% NA
All Japonica  1512 75.90% 24.10% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 82.20% 17.80% 0.00% 0.00% NA
Indica II  465 72.70% 27.30% 0.00% 0.00% NA
Indica III  913 41.70% 58.10% 0.22% 0.00% NA
Indica Intermediate  786 66.70% 33.30% 0.00% 0.00% NA
Temperate Japonica  767 83.10% 16.90% 0.00% 0.00% NA
Tropical Japonica  504 70.40% 29.60% 0.00% 0.00% NA
Japonica Intermediate  241 64.70% 35.30% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217468587 G -> A LOC_Os12g29400.1 upstream_gene_variant ; 3322.0bp to feature; MODIFIER silent_mutation Average:96.959; most accessible tissue: Minghui63 root, score: 99.257 N N N N
vg1217468587 G -> A LOC_Os12g29410.1 upstream_gene_variant ; 278.0bp to feature; MODIFIER silent_mutation Average:96.959; most accessible tissue: Minghui63 root, score: 99.257 N N N N
vg1217468587 G -> A LOC_Os12g29420.1 downstream_gene_variant ; 1504.0bp to feature; MODIFIER silent_mutation Average:96.959; most accessible tissue: Minghui63 root, score: 99.257 N N N N
vg1217468587 G -> A LOC_Os12g29410-LOC_Os12g29420 intergenic_region ; MODIFIER silent_mutation Average:96.959; most accessible tissue: Minghui63 root, score: 99.257 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217468587 G A 0.02 0.02 0.03 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217468587 NA 2.78E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587 NA 3.56E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587 NA 2.41E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587 NA 7.06E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587 NA 3.74E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587 NA 1.75E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587 1.50E-06 1.50E-06 mr1260_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251