Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217468587:

Variant ID: vg1217468587 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17468587
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAACTCGATTTAGACCGAGGACCGAACCGAACTATCGGTTAACCGATCTGTCGGTCAGTACTCTTCTATAGGTGAGTTCGGTTTCCTTTTCTCAAAGACC[G/A]
ATCTTTTTAAAGACCGAATTAACCGGACCGACCTTTCGGTCTACACCGAATACGCACCACTAGCTGTTCCATTCCCTCTATTTTGGGCCATCGGTCCGCC

Reverse complement sequence

GGCGGACCGATGGCCCAAAATAGAGGGAATGGAACAGCTAGTGGTGCGTATTCGGTGTAGACCGAAAGGTCGGTCCGGTTAATTCGGTCTTTAAAAAGAT[C/T]
GGTCTTTGAGAAAAGGAAACCGAACTCACCTATAGAAGAGTACTGACCGACAGATCGGTTAACCGATAGTTCGGTTCGGTCCTCGGTCTAAATCGAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.90%	30.00%	0.04%	0.00%	NA
All Indica	2759	62.80%	37.20%	0.07%	0.00%	NA
All Japonica	1512	75.90%	24.10%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	82.20%	17.80%	0.00%	0.00%	NA
Indica II	465	72.70%	27.30%	0.00%	0.00%	NA
Indica III	913	41.70%	58.10%	0.22%	0.00%	NA
Indica Intermediate	786	66.70%	33.30%	0.00%	0.00%	NA
Temperate Japonica	767	83.10%	16.90%	0.00%	0.00%	NA
Tropical Japonica	504	70.40%	29.60%	0.00%	0.00%	NA
Japonica Intermediate	241	64.70%	35.30%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217468587	G -> A	LOC_Os12g29400.1	upstream_gene_variant ; 3322.0bp to feature; MODIFIER	silent_mutation	Average:96.959; most accessible tissue: Minghui63 root, score: 99.257	N	N	N	N
vg1217468587	G -> A	LOC_Os12g29410.1	upstream_gene_variant ; 278.0bp to feature; MODIFIER	silent_mutation	Average:96.959; most accessible tissue: Minghui63 root, score: 99.257	N	N	N	N
vg1217468587	G -> A	LOC_Os12g29420.1	downstream_gene_variant ; 1504.0bp to feature; MODIFIER	silent_mutation	Average:96.959; most accessible tissue: Minghui63 root, score: 99.257	N	N	N	N
vg1217468587	G -> A	LOC_Os12g29410-LOC_Os12g29420	intergenic_region ; MODIFIER	silent_mutation	Average:96.959; most accessible tissue: Minghui63 root, score: 99.257	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1217468587	G	A	0.02	0.02	0.03	0.0	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217468587	NA	2.78E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587	NA	3.56E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587	NA	2.41E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587	NA	7.06E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587	NA	3.74E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587	NA	1.75E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217468587	1.50E-06	1.50E-06	mr1260_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251