Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217467868:

Variant ID: vg1217467868 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17467868
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTCTACCTGTGAAGGAAGAAGAAACGAAGAAATGGTGAAGAGAAATGGAAAGAGAATAGAAGAGGAGGATGAAGAAAAAAGATAAATCTGATGGATGG[T/G]
TCCCATGTATAGATGAAAGAGAAGCTGAAAAACTTAACGGCGATGACATGGTTTTAATTTTATAAAATATAAGTGGCATAATTATAAATAATCAAATTGT

Reverse complement sequence

ACAATTTGATTATTTATAATTATGCCACTTATATTTTATAAAATTAAAACCATGTCATCGCCGTTAAGTTTTTCAGCTTCTCTTTCATCTATACATGGGA[A/C]
CCATCCATCAGATTTATCTTTTTTCTTCATCCTCCTCTTCTATTCTCTTTCCATTTCTCTTCACCATTTCTTCGTTTCTTCTTCCTTCACAGGTAGAGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 18.00% 0.99% 2.31% NA
All Indica  2759 92.90% 2.00% 1.20% 3.88% NA
All Japonica  1512 49.00% 50.90% 0.00% 0.13% NA
Aus  269 96.70% 0.00% 3.35% 0.00% NA
Indica I  595 95.60% 2.90% 0.50% 1.01% NA
Indica II  465 91.20% 2.60% 1.94% 4.30% NA
Indica III  913 94.20% 0.10% 0.77% 4.93% NA
Indica Intermediate  786 90.50% 3.20% 1.78% 4.58% NA
Temperate Japonica  767 10.00% 90.00% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.00% 0.40% NA
Japonica Intermediate  241 68.90% 31.10% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217467868 T -> DEL N N silent_mutation Average:89.771; most accessible tissue: Minghui63 panicle, score: 95.282 N N N N
vg1217467868 T -> G LOC_Os12g29400.1 upstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:89.771; most accessible tissue: Minghui63 panicle, score: 95.282 N N N N
vg1217467868 T -> G LOC_Os12g29390.1 downstream_gene_variant ; 4628.0bp to feature; MODIFIER silent_mutation Average:89.771; most accessible tissue: Minghui63 panicle, score: 95.282 N N N N
vg1217467868 T -> G LOC_Os12g29420.1 downstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:89.771; most accessible tissue: Minghui63 panicle, score: 95.282 N N N N
vg1217467868 T -> G LOC_Os12g29410.1 intron_variant ; MODIFIER silent_mutation Average:89.771; most accessible tissue: Minghui63 panicle, score: 95.282 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217467868 T G 0.11 0.11 0.1 0.09 0.1 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217467868 NA 3.03E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 3.79E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.33E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 9.84E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 3.38E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.12E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 2.46E-20 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.92E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 4.02E-10 4.47E-89 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.35E-13 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.67E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.26E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 2.87E-16 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 3.21E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 5.19E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 3.94E-22 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.37E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 8.93E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.28E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 4.31E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 2.16E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 3.31E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 9.89E-10 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 2.71E-19 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.38E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 4.37E-21 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 2.35E-09 1.09E-96 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 4.16E-16 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 4.07E-26 mr1361_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 5.49E-11 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 2.02E-34 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 6.10E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 6.54E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.56E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 6.52E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 7.21E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 5.49E-28 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.22E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.45E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.21E-42 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 2.75E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.56E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.35E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 2.46E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 5.60E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 3.13E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217467868 NA 1.87E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251