\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217465756:

Variant ID: vg1217465756 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17465756
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGTGTAATGATATATTTTATATTAATTTATCTTGTGGCTTTTTAATATTTTATCTATAACTATTAACATATACAAAACGAGAGGACATATAATCGAG[G/A]
GATGAAATCACTTTTCCGGATGATTGGCTTATTTGTGGAGAGGCCTCCTGTTTACCTCTGTACAGAATCCGTTGTCTAAATTTAAATTTTGAAATTTAGT

Reverse complement sequence

ACTAAATTTCAAAATTTAAATTTAGACAACGGATTCTGTACAGAGGTAAACAGGAGGCCTCTCCACAAATAAGCCAATCATCCGGAAAAGTGATTTCATC[C/T]
CTCGATTATATGTCCTCTCGTTTTGTATATGTTAATAGTTATAGATAAAATATTAAAAAGCCACAAGATAAATTAATATAAAATATATCATTACACAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 5.10% 2.86% 0.19% NA
All Indica  2759 94.70% 2.00% 3.04% 0.29% NA
All Japonica  1512 87.00% 10.00% 3.04% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 98.80% 0.00% 1.18% 0.00% NA
Indica II  465 82.40% 9.20% 8.39% 0.00% NA
Indica III  913 96.50% 0.40% 2.52% 0.55% NA
Indica Intermediate  786 96.70% 1.00% 1.91% 0.38% NA
Temperate Japonica  767 97.90% 0.10% 1.96% 0.00% NA
Tropical Japonica  504 69.00% 27.40% 3.57% 0.00% NA
Japonica Intermediate  241 89.60% 5.00% 5.39% 0.00% NA
VI/Aromatic  96 75.00% 22.90% 2.08% 0.00% NA
Intermediate  90 84.40% 12.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217465756 G -> DEL N N silent_mutation Average:53.96; most accessible tissue: Callus, score: 88.164 N N N N
vg1217465756 G -> A LOC_Os12g29400.1 upstream_gene_variant ; 491.0bp to feature; MODIFIER silent_mutation Average:53.96; most accessible tissue: Callus, score: 88.164 N N N N
vg1217465756 G -> A LOC_Os12g29390.1 downstream_gene_variant ; 2516.0bp to feature; MODIFIER silent_mutation Average:53.96; most accessible tissue: Callus, score: 88.164 N N N N
vg1217465756 G -> A LOC_Os12g29410.1 downstream_gene_variant ; 1898.0bp to feature; MODIFIER silent_mutation Average:53.96; most accessible tissue: Callus, score: 88.164 N N N N
vg1217465756 G -> A LOC_Os12g29420.1 downstream_gene_variant ; 4335.0bp to feature; MODIFIER silent_mutation Average:53.96; most accessible tissue: Callus, score: 88.164 N N N N
vg1217465756 G -> A LOC_Os12g29400-LOC_Os12g29410 intergenic_region ; MODIFIER silent_mutation Average:53.96; most accessible tissue: Callus, score: 88.164 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217465756 9.87E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 8.22E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 3.37E-09 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 3.54E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 3.14E-07 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 9.38E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 5.23E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 6.34E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 1.92E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 2.62E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 1.90E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 7.61E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 5.34E-06 3.04E-09 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 5.37E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 1.15E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 1.37E-06 1.37E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 2.70E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 5.86E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 8.52E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 3.82E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 4.95E-08 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 5.88E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 8.04E-09 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 2.49E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 2.81E-06 5.92E-10 mr1364_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 2.72E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 1.20E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217465756 NA 9.36E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251