\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217449731:

Variant ID: vg1217449731 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17449731
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CATTAACCGTGTCAACCACAAGCCAGCGTGGGCAACGGCTTTACCTATTGTATAGCATGGTTCATTGCGGGGCACCAGACTGAGAAGTGGCGGAGATAAG[T/C]
CCACGGGGGTCGCTGGGGAGTCCATGCCTTGTTTATAAGGGGGTGATTATGATCCAGGAATGGTGCGCTGTGGTGGATTGTGTTGTGCGTGGGGTACTGT

Reverse complement sequence

ACAGTACCCCACGCACAACACAATCCACCACAGCGCACCATTCCTGGATCATAATCACCCCCTTATAAACAAGGCATGGACTCCCCAGCGACCCCCGTGG[A/G]
CTTATCTCCGCCACTTCTCAGTCTGGTGCCCCGCAATGAACCATGCTATACAATAGGTAAAGCCGTTGCCCACGCTGGCTTGTGGTTGACACGGTTAATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.00% 13.50% 57.91% 9.56% NA
All Indica  2759 5.30% 21.50% 71.77% 1.41% NA
All Japonica  1512 44.00% 1.30% 31.42% 23.35% NA
Aus  269 24.20% 5.90% 62.83% 7.06% NA
Indica I  595 4.50% 25.20% 68.74% 1.51% NA
Indica II  465 7.10% 9.20% 81.72% 1.94% NA
Indica III  913 4.20% 27.30% 68.24% 0.33% NA
Indica Intermediate  786 6.10% 19.30% 72.26% 2.29% NA
Temperate Japonica  767 77.70% 0.30% 6.13% 15.91% NA
Tropical Japonica  504 1.20% 2.60% 65.67% 30.56% NA
Japonica Intermediate  241 26.10% 1.70% 40.25% 31.95% NA
VI/Aromatic  96 2.10% 2.10% 64.58% 31.25% NA
Intermediate  90 24.40% 6.70% 56.67% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217449731 T -> C LOC_Os12g29380.1 downstream_gene_variant ; 3628.0bp to feature; MODIFIER silent_mutation Average:20.872; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1217449731 T -> C LOC_Os12g29370-LOC_Os12g29380 intergenic_region ; MODIFIER silent_mutation Average:20.872; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1217449731 T -> DEL N N silent_mutation Average:20.872; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217449731 NA 3.26E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 1.08E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 1.05E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 1.49E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 1.93E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 2.14E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 5.92E-07 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 1.60E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 4.93E-15 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 3.56E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 6.41E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 5.25E-06 6.21E-08 mr1388_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 2.71E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 5.44E-08 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 6.20E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 6.23E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 4.33E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 1.58E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 6.72E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731 NA 5.67E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251