Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217445507:

Variant ID: vg1217445507 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17445507
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGTGATCAGAGATAATGGAGGAGGCCGCTTGAAGGAGACAAGATGGGAAAAACTCCTCGCAATCCGTGGAAAAGAAGACATGATCAAGTTTGACGATC[G/A]
TGGGGGAATCGCGCTCTATGCACCAAGTGAAGCGACGGCCATGGAGTGGCAATTCTCGGAGGTCCAGCTCGTCAATCAGCCGTGAAGCGGCCCATCATGC

Reverse complement sequence

GCATGATGGGCCGCTTCACGGCTGATTGACGAGCTGGACCTCCGAGAATTGCCACTCCATGGCCGTCGCTTCACTTGGTGCATAGAGCGCGATTCCCCCA[C/T]
GATCGTCAAACTTGATCATGTCTTCTTTTCCACGGATTGCGAGGAGTTTTTCCCATCTTGTCTCCTTCAAGCGGCCTCCTCCATTATCTCTGATCACTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	28.60%	0.21%	0.00%	NA
All Indica	2759	69.30%	30.50%	0.22%	0.00%	NA
All Japonica	1512	78.20%	21.70%	0.13%	0.00%	NA
Aus	269	65.10%	34.90%	0.00%	0.00%	NA
Indica I	595	83.50%	16.50%	0.00%	0.00%	NA
Indica II	465	89.70%	10.30%	0.00%	0.00%	NA
Indica III	913	45.00%	54.80%	0.22%	0.00%	NA
Indica Intermediate	786	74.70%	24.80%	0.51%	0.00%	NA
Temperate Japonica	767	95.00%	5.00%	0.00%	0.00%	NA
Tropical Japonica	504	57.70%	42.10%	0.20%	0.00%	NA
Japonica Intermediate	241	67.20%	32.40%	0.41%	0.00%	NA
VI/Aromatic	96	38.50%	60.40%	1.04%	0.00%	NA
Intermediate	90	64.40%	34.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217445507	G -> A	LOC_Os12g29370.1	downstream_gene_variant ; 1866.0bp to feature; MODIFIER	silent_mutation	Average:64.004; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1217445507	G -> A	LOC_Os12g29370-LOC_Os12g29380	intergenic_region ; MODIFIER	silent_mutation	Average:64.004; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217445507	NA	3.90E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217445507	NA	8.38E-07	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217445507	NA	6.02E-06	mr1743	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217445507	NA	6.14E-06	mr1930	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217445507	NA	7.22E-06	mr1013_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217445507	NA	4.63E-06	mr1031_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217445507	NA	7.04E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251