RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1217404715:

Variant ID: vg1217404715 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17404715
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACTCCACACAAAATAAATTAAATTTCGATTACTATATGAATTTAGAGAATAGATTTATTTGTTATTTTAAAGTAACTTAATATATATAATTTTTGTAAA[C/T]
AAAATGCATTGTTTGACAGTTCTATTATATTTTTTAAACAAAATGCATCGTTTAACAATTCTATTATAAATCAAGTTAAAATTTGTATGTTAATCAGAAA

Reverse complement sequence

TTTCTGATTAACATACAAATTTTAACTTGATTTATAATAGAATTGTTAAACGATGCATTTTGTTTAAAAAATATAATAGAACTGTCAAACAATGCATTTT[G/A]
TTTACAAAAATTATATATATTAAGTTACTTTAAAATAACAAATAAATCTATTCTCTAAATTCATATAGTAATCGAAATTTAATTTATTTTGTGTGGAGTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	13.20%	0.08%	0.00%	NA
All Indica	2759	95.10%	4.90%	0.00%	0.00%	NA
All Japonica	1512	78.80%	21.10%	0.13%	0.00%	NA
Aus	269	41.30%	58.40%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	82.20%	17.80%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	95.40%	4.60%	0.00%	0.00%	NA
Tropical Japonica	504	58.10%	41.50%	0.40%	0.00%	NA
Japonica Intermediate	241	68.90%	31.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	12.20%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217404715	C -> T	LOC_Os12g29340.1	downstream_gene_variant ; 1474.0bp to feature; MODIFIER	silent_mutation	Average:75.492; most accessible tissue: Zhenshan97 root, score: 89.337	N	N	N	N
vg1217404715	C -> T	LOC_Os12g29330-LOC_Os12g29340	intergenic_region ; MODIFIER	silent_mutation	Average:75.492; most accessible tissue: Zhenshan97 root, score: 89.337	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217404715	NA	4.54E-08	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217404715	NA	2.31E-06	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217404715	3.52E-06	3.52E-06	mr1601	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217404715	1.49E-06	1.22E-07	mr1602	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217404715	NA	3.54E-07	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217404715	NA	3.97E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1217404715:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact