\
| Variant ID: vg1217404715 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17404715 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TACTCCACACAAAATAAATTAAATTTCGATTACTATATGAATTTAGAGAATAGATTTATTTGTTATTTTAAAGTAACTTAATATATATAATTTTTGTAAA[C/T]
AAAATGCATTGTTTGACAGTTCTATTATATTTTTTAAACAAAATGCATCGTTTAACAATTCTATTATAAATCAAGTTAAAATTTGTATGTTAATCAGAAA
TTTCTGATTAACATACAAATTTTAACTTGATTTATAATAGAATTGTTAAACGATGCATTTTGTTTAAAAAATATAATAGAACTGTCAAACAATGCATTTT[G/A]
TTTACAAAAATTATATATATTAAGTTACTTTAAAATAACAAATAAATCTATTCTCTAAATTCATATAGTAATCGAAATTTAATTTATTTTGTGTGGAGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 13.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.80% | 21.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 41.30% | 58.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 58.10% | 41.50% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217404715 | C -> T | LOC_Os12g29340.1 | downstream_gene_variant ; 1474.0bp to feature; MODIFIER | silent_mutation | Average:75.492; most accessible tissue: Zhenshan97 root, score: 89.337 | N | N | N | N |
| vg1217404715 | C -> T | LOC_Os12g29330-LOC_Os12g29340 | intergenic_region ; MODIFIER | silent_mutation | Average:75.492; most accessible tissue: Zhenshan97 root, score: 89.337 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217404715 | NA | 4.54E-08 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217404715 | NA | 2.31E-06 | mr1388 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217404715 | 3.52E-06 | 3.52E-06 | mr1601 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217404715 | 1.49E-06 | 1.22E-07 | mr1602 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217404715 | NA | 3.54E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217404715 | NA | 3.97E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |