\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217403986:

Variant ID: vg1217403986 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17403986
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGTGAAATATGTAAAACTATATGTATACATAAAAGTATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAATTTTTTTAATAAG[G/A]
CGAATGGTCAAACATGTTTAAAAAAGTCAAATGGTGTCAAATATTTACGGTCAGAGGGAGTAAGTCAAAGCAAAAGTCTAAAATTTAAATTTTAAAGTTT

Reverse complement sequence

AAACTTTAAAATTTAAATTTTAGACTTTTGCTTTGACTTACTCCCTCTGACCGTAAATATTTGACACCATTTGACTTTTTTAAACATGTTTGACCATTCG[C/T]
CTTATTAAAAAAATTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATACTTTTATGTATACATATAGTTTTACATATTTCACTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.40% 14.60% 10.88% 34.11% NA
All Indica  2759 30.70% 24.10% 12.61% 32.55% NA
All Japonica  1512 55.40% 0.50% 7.94% 36.24% NA
Aus  269 35.30% 1.10% 11.90% 51.67% NA
Indica I  595 11.30% 10.30% 19.33% 59.16% NA
Indica II  465 65.60% 6.90% 9.89% 17.63% NA
Indica III  913 21.20% 45.80% 10.30% 22.67% NA
Indica Intermediate  786 35.90% 19.60% 11.83% 32.70% NA
Temperate Japonica  767 79.40% 0.30% 11.47% 8.87% NA
Tropical Japonica  504 29.40% 1.00% 0.79% 68.85% NA
Japonica Intermediate  241 33.20% 0.00% 11.62% 55.19% NA
VI/Aromatic  96 85.40% 3.10% 3.12% 8.33% NA
Intermediate  90 51.10% 15.60% 12.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217403986 G -> DEL N N silent_mutation Average:61.454; most accessible tissue: Callus, score: 80.794 N N N N
vg1217403986 G -> A LOC_Os12g29340.1 downstream_gene_variant ; 2203.0bp to feature; MODIFIER silent_mutation Average:61.454; most accessible tissue: Callus, score: 80.794 N N N N
vg1217403986 G -> A LOC_Os12g29330-LOC_Os12g29340 intergenic_region ; MODIFIER silent_mutation Average:61.454; most accessible tissue: Callus, score: 80.794 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217403986 NA 2.53E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 4.16E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 1.98E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 3.83E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 8.92E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 8.14E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 3.18E-09 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 2.25E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 3.90E-07 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 5.11E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 1.52E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 1.16E-12 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 2.44E-07 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 4.40E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 3.58E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 5.82E-11 mr1378_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 7.46E-06 mr1400_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 5.14E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 5.14E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 7.06E-07 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 6.79E-07 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 4.12E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 3.29E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 8.26E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 7.72E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 2.59E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 2.08E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 2.07E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 4.10E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 8.17E-06 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 6.50E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 2.58E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403986 NA 5.00E-07 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251