\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217403317:

Variant ID: vg1217403317 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 17403317
Reference Allele: GAlternative Allele: A,GTATA,GCATA
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATTTCTCTAGTAATACCAACATGTATCCTAATAAGGATCTATAATTAATCGAGAATCGCAGGAGTACTGTGCCAAACGGTCCCTAGAATAATCCCAT[G/A,GTATA,GCATA]
ATGCAGGGAGGACACATCACAGTAGGGTGGAACCAAACCGAATTAACCAACCATGATATGCATGATCACACACATGCATTGACCAATCAGATGATCATCG

Reverse complement sequence

CGATGATCATCTGATTGGTCAATGCATGTGTGTGATCATGCATATCATGGTTGGTTAATTCGGTTTGGTTCCACCCTACTGTGATGTGTCCTCCCTGCAT[C/T,TATAC,TATGC]
ATGGGATTATTCTAGGGACCGTTTGGCACAGTACTCCTGCGATTCTCGATTAATTATAGATCCTTATTAGGATACATGTTGGTATTACTAGAGAAATTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 18.90% 7.70% 8.78% GTATA: 6.12%; GCATA: 3.13%
All Indica  2759 70.80% 7.80% 8.59% 10.15% GTATA: 1.70%; GCATA: 0.98%
All Japonica  1512 17.30% 43.50% 7.74% 8.27% GTATA: 15.48%; GCATA: 7.74%
Aus  269 95.20% 0.40% 1.49% 2.23% GTATA: 0.74%
Indica I  595 56.10% 3.00% 23.53% 16.97% GTATA: 0.17%; GCATA: 0.17%
Indica II  465 80.00% 7.30% 3.87% 6.88% GTATA: 1.72%; GCATA: 0.22%
Indica III  913 76.80% 9.50% 2.52% 6.79% GTATA: 2.96%; GCATA: 1.42%
Indica Intermediate  786 69.60% 9.50% 7.12% 10.81% GCATA: 1.53%; GTATA: 1.40%
Temperate Japonica  767 1.80% 77.30% 2.74% 1.83% GCATA: 11.99%; GTATA: 4.30%
Tropical Japonica  504 41.30% 1.40% 13.89% 15.48% GTATA: 27.78%; GCATA: 0.20%
Japonica Intermediate  241 16.20% 24.10% 10.79% 13.69% GTATA: 25.31%; GCATA: 9.96%
VI/Aromatic  96 99.00% 0.00% 0.00% 0.00% GTATA: 1.04%
Intermediate  90 55.60% 23.30% 6.67% 4.44% GTATA: 5.56%; GCATA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217403317 G -> GCATA LOC_Os12g29340.1 downstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:87.004; most accessible tissue: Callus, score: 94.191 N N N N
vg1217403317 G -> GCATA LOC_Os12g29330-LOC_Os12g29340 intergenic_region ; MODIFIER silent_mutation Average:87.004; most accessible tissue: Callus, score: 94.191 N N N N
vg1217403317 G -> DEL N N silent_mutation Average:87.004; most accessible tissue: Callus, score: 94.191 N N N N
vg1217403317 G -> A LOC_Os12g29340.1 downstream_gene_variant ; 2872.0bp to feature; MODIFIER silent_mutation Average:87.004; most accessible tissue: Callus, score: 94.191 N N N N
vg1217403317 G -> A LOC_Os12g29330-LOC_Os12g29340 intergenic_region ; MODIFIER silent_mutation Average:87.004; most accessible tissue: Callus, score: 94.191 N N N N
vg1217403317 G -> GTATA LOC_Os12g29340.1 downstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:87.004; most accessible tissue: Callus, score: 94.191 N N N N
vg1217403317 G -> GTATA LOC_Os12g29330-LOC_Os12g29340 intergenic_region ; MODIFIER silent_mutation Average:87.004; most accessible tissue: Callus, score: 94.191 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217403317 G A 0.02 -0.05 -0.05 -0.06 -0.05 -0.04
vg1217403317 G GCATA 0.1 -0.07 -0.05 0.01 -0.09 -0.18
vg1217403317 G GTATA 0.17 -0.05 -0.03 -0.01 -0.12 -0.21

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217403317 NA 6.06E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217403317 NA 6.52E-29 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217403317 NA 1.20E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217403317 NA 7.30E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217403317 NA 3.95E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217403317 NA 1.69E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.30E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.48E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 2.67E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 2.06E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.60E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 3.04E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 3.45E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 5.76E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 5.99E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 2.10E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.06E-06 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 2.20E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.37E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.88E-09 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 3.67E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 9.87E-08 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.58E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 3.05E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 6.10E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 6.47E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 4.09E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 3.61E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 2.35E-10 mr1359_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.04E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.13E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 3.18E-08 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 9.00E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.70E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 2.95E-08 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 3.24E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.01E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.50E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 8.99E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 2.66E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 8.72E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 5.94E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 7.56E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 5.38E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 5.82E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 1.94E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 7.14E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217403317 NA 3.08E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251