Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217371642:

Variant ID: vg1217371642 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17371642
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAACAGTTTACACACCATTCCCTCCTGACCTTCTAGTACATACCCGTCTGGTTGGTCCATATAGATCTCCTCCTCCAGATCTCCGTTTAGGAAAGCTGT[C/T]
TTAATGTTCATCTGATGGACGAGAAGACCATGAGAGGCTGCCAGAGCAAGTAGTACTCGAATCATGGTCAAGCGAGCAACTGGTGAATATGTGTCAAAAA

Reverse complement sequence

TTTTTGACACATATTCACCAGTTGCTCGCTTGACCATGATTCGAGTACTACTTGCTCTGGCAGCCTCTCATGGTCTTCTCGTCCATCAGATGAACATTAA[G/A]
ACAGCTTTCCTAAACGGAGATCTGGAGGAGGAGATCTATATGGACCAACCAGACGGGTATGTACTAGAAGGTCAGGAGGGAATGGTGTGTAAACTGTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	11.00%	3.72%	26.91%	NA
All Indica	2759	59.60%	0.60%	5.73%	34.14%	NA
All Japonica	1512	58.70%	31.00%	0.00%	10.38%	NA
Aus	269	60.20%	7.80%	4.83%	27.14%	NA
Indica I	595	80.30%	0.20%	6.05%	13.45%	NA
Indica II	465	75.10%	0.40%	1.08%	23.44%	NA
Indica III	913	36.60%	0.40%	7.67%	55.31%	NA
Indica Intermediate	786	61.30%	1.10%	5.98%	31.55%	NA
Temperate Japonica	767	93.20%	6.40%	0.00%	0.39%	NA
Tropical Japonica	504	13.50%	59.30%	0.00%	27.18%	NA
Japonica Intermediate	241	43.20%	49.80%	0.00%	7.05%	NA
VI/Aromatic	96	17.70%	0.00%	2.08%	80.21%	NA
Intermediate	90	54.40%	16.70%	3.33%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217371642	C -> DEL	LOC_Os12g29310.1	N	frameshift_variant	Average:18.86; most accessible tissue: Zhenshan97 flower, score: 50.724	N	N	N	N
vg1217371642	C -> T	LOC_Os12g29310.1	synonymous_variant ; p.Lys800Lys; LOW	synonymous_codon	Average:18.86; most accessible tissue: Zhenshan97 flower, score: 50.724	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217371642	7.15E-07	NA	mr1016	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	7.85E-07	NA	mr1017	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	3.35E-07	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	3.91E-06	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	1.69E-07	mr1388	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	3.69E-06	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	8.36E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	1.68E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	9.29E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	3.77E-06	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	8.91E-06	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	1.98E-07	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	3.22E-06	mr1043_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	2.04E-07	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	3.56E-06	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	1.12E-06	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	6.74E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	1.96E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	2.47E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	1.54E-06	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	5.49E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	1.40E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	1.50E-09	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	2.41E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	1.40E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	1.85E-13	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	2.36E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642	NA	7.67E-07	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251