\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217371642:

Variant ID: vg1217371642 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17371642
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAACAGTTTACACACCATTCCCTCCTGACCTTCTAGTACATACCCGTCTGGTTGGTCCATATAGATCTCCTCCTCCAGATCTCCGTTTAGGAAAGCTGT[C/T]
TTAATGTTCATCTGATGGACGAGAAGACCATGAGAGGCTGCCAGAGCAAGTAGTACTCGAATCATGGTCAAGCGAGCAACTGGTGAATATGTGTCAAAAA

Reverse complement sequence

TTTTTGACACATATTCACCAGTTGCTCGCTTGACCATGATTCGAGTACTACTTGCTCTGGCAGCCTCTCATGGTCTTCTCGTCCATCAGATGAACATTAA[G/A]
ACAGCTTTCCTAAACGGAGATCTGGAGGAGGAGATCTATATGGACCAACCAGACGGGTATGTACTAGAAGGTCAGGAGGGAATGGTGTGTAAACTGTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 11.00% 3.72% 26.91% NA
All Indica  2759 59.60% 0.60% 5.73% 34.14% NA
All Japonica  1512 58.70% 31.00% 0.00% 10.38% NA
Aus  269 60.20% 7.80% 4.83% 27.14% NA
Indica I  595 80.30% 0.20% 6.05% 13.45% NA
Indica II  465 75.10% 0.40% 1.08% 23.44% NA
Indica III  913 36.60% 0.40% 7.67% 55.31% NA
Indica Intermediate  786 61.30% 1.10% 5.98% 31.55% NA
Temperate Japonica  767 93.20% 6.40% 0.00% 0.39% NA
Tropical Japonica  504 13.50% 59.30% 0.00% 27.18% NA
Japonica Intermediate  241 43.20% 49.80% 0.00% 7.05% NA
VI/Aromatic  96 17.70% 0.00% 2.08% 80.21% NA
Intermediate  90 54.40% 16.70% 3.33% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217371642 C -> DEL LOC_Os12g29310.1 N frameshift_variant Average:18.86; most accessible tissue: Zhenshan97 flower, score: 50.724 N N N N
vg1217371642 C -> T LOC_Os12g29310.1 synonymous_variant ; p.Lys800Lys; LOW synonymous_codon Average:18.86; most accessible tissue: Zhenshan97 flower, score: 50.724 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217371642 7.15E-07 NA mr1016 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 7.85E-07 NA mr1017 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 3.35E-07 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 3.91E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 1.69E-07 mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 3.69E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 8.36E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 1.68E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 9.29E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 3.77E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 8.91E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 1.98E-07 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 3.22E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 2.04E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 3.56E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 1.12E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 6.74E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 1.96E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 2.47E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 1.54E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 5.49E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 1.40E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 1.50E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 2.41E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 1.40E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 1.85E-13 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 2.36E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217371642 NA 7.67E-07 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251