\
| Variant ID: vg1217338702 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17338702 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACCGGACACATTCTTCACCCCCAACTACGCAAGCCGAACAAATAACCCCCTCCCTGCCCCGGCCTCAAACCATGGTGGTTTTGTCCTACGTGGCAGTCC[A/T]
GTCAATATTTTTTTAAAAAAATAAGTAGGGCCCACCTGTCAGTTCCCACACCTATCTATCTCTCTCTCTCCCCAATCTCTCTCACTCTCTCTCTCTCTAT
ATAGAGAGAGAGAGAGTGAGAGAGATTGGGGAGAGAGAGAGATAGATAGGTGTGGGAACTGACAGGTGGGCCCTACTTATTTTTTTAAAAAAATATTGAC[T/A]
GGACTGCCACGTAGGACAAAACCACCATGGTTTGAGGCCGGGGCAGGGAGGGGGTTATTTGTTCGGCTTGCGTAGTTGGGGGTGAAGAATGTGTCCGGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 12.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 96.20% | 3.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217338702 | A -> T | LOC_Os12g29250-LOC_Os12g29280 | intergenic_region ; MODIFIER | silent_mutation | Average:52.355; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217338702 | 5.89E-06 | 7.12E-08 | mr1388 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217338702 | NA | 6.31E-07 | mr1388 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217338702 | NA | 7.12E-09 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217338702 | NA | 3.81E-06 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217338702 | NA | 3.40E-06 | mr1695 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217338702 | 1.55E-06 | 1.07E-12 | mr1458_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |