\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217327067:

Variant ID: vg1217327067 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17327067
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GATTATCGTCGAAGTGGTTTTGGAAATAATCAATTTTCAGGTGATGATCGGATTCACTATTATTTTATGTGATCGGTCCGACCGGGTGGAGCTTGCCGGT[C/T]
AGACCGGCGCTATGTGTGCGGTCAGACCGGCCAGGCCCGCGGTTTGACCGGCCGACACTGTGTCGGTTTCGGTTTCGGGTTGTTTCTTTGGATATCCATG

Reverse complement sequence

CATGGATATCCAAAGAAACAACCCGAAACCGAAACCGACACAGTGTCGGCCGGTCAAACCGCGGGCCTGGCCGGTCTGACCGCACACATAGCGCCGGTCT[G/A]
ACCGGCAAGCTCCACCCGGTCGGACCGATCACATAAAATAATAGTGAATCCGATCATCACCTGAAAATTGATTATTTCCAAAACCACTTCGACGATAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 33.60% 0.59% 8.32% NA
All Indica  2759 44.20% 52.00% 0.65% 3.12% NA
All Japonica  1512 82.70% 7.80% 0.40% 9.13% NA
Aus  269 46.10% 2.20% 0.74% 50.93% NA
Indica I  595 79.30% 20.70% 0.00% 0.00% NA
Indica II  465 35.10% 54.80% 1.29% 8.82% NA
Indica III  913 26.70% 71.30% 0.11% 1.86% NA
Indica Intermediate  786 43.30% 51.80% 1.40% 3.56% NA
Temperate Japonica  767 96.90% 3.00% 0.00% 0.13% NA
Tropical Japonica  504 60.70% 13.50% 0.99% 24.80% NA
Japonica Intermediate  241 83.40% 11.20% 0.41% 4.98% NA
VI/Aromatic  96 69.80% 4.20% 2.08% 23.96% NA
Intermediate  90 65.60% 24.40% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217327067 C -> DEL N N silent_mutation Average:22.417; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1217327067 C -> T LOC_Os12g29250.1 downstream_gene_variant ; 3758.0bp to feature; MODIFIER silent_mutation Average:22.417; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1217327067 C -> T LOC_Os12g29250-LOC_Os12g29280 intergenic_region ; MODIFIER silent_mutation Average:22.417; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217327067 6.74E-06 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 3.69E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 2.41E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 5.53E-06 2.12E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 1.84E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 3.32E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 5.80E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 2.35E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 1.10E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 2.31E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.04E-06 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 4.04E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 2.12E-06 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 6.82E-13 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 4.02E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 2.02E-07 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 8.92E-06 NA mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 NA 1.51E-08 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.80E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 2.80E-08 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 3.35E-06 4.13E-14 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 6.25E-11 NA mr1079_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.12E-08 NA mr1079_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.16E-11 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.05E-07 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.60E-07 3.47E-16 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 3.44E-07 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.47E-07 3.04E-16 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.49E-12 NA mr1390_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.27E-07 NA mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 4.91E-09 8.99E-18 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 4.85E-09 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 3.44E-07 7.68E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 9.73E-06 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 5.20E-13 NA mr1490_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 2.05E-08 NA mr1490_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 1.30E-08 8.40E-18 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217327067 9.35E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251