\
| Variant ID: vg1217303672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17303672 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATATTTTACTACTACAAAACGGTAAATATGGAACAATCTTATATAGGTGCCGGTTCTTGTTCACAACCGATGACACCTGTAAGGGGCCTCTCATCGGTG[C/T]
CGGTTGCGACTCGAGAATCAAAGGGTGGTTCCCAAGTCCCCACCGGCATCGAAATAGGGTTTCTGTGGTAGTGCTAGGGTTTGGATGACATGGATCGAAC
GTTCGATCCATGTCATCCAAACCCTAGCACTACCACAGAAACCCTATTTCGATGCCGGTGGGGACTTGGGAACCACCCTTTGATTCTCGAGTCGCAACCG[G/A]
CACCGATGAGAGGCCCCTTACAGGTGTCATCGGTTGTGAACAAGAACCGGCACCTATATAAGATTGTTCCATATTTACCGTTTTGTAGTAGTAAAATATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 21.30% | 0.36% | 22.51% | NA |
| All Indica | 2759 | 37.40% | 28.30% | 0.51% | 33.82% | NA |
| All Japonica | 1512 | 81.10% | 12.90% | 0.00% | 6.02% | NA |
| Aus | 269 | 91.40% | 1.10% | 0.00% | 7.43% | NA |
| Indica I | 595 | 9.60% | 12.90% | 0.34% | 77.14% | NA |
| Indica II | 465 | 81.50% | 4.50% | 0.22% | 13.76% | NA |
| Indica III | 913 | 27.20% | 52.50% | 0.44% | 19.93% | NA |
| Indica Intermediate | 786 | 44.10% | 26.00% | 0.89% | 29.01% | NA |
| Temperate Japonica | 767 | 96.60% | 0.80% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 58.10% | 31.30% | 0.00% | 10.52% | NA |
| Japonica Intermediate | 241 | 79.70% | 12.90% | 0.00% | 7.47% | NA |
| VI/Aromatic | 96 | 86.50% | 3.10% | 1.04% | 9.38% | NA |
| Intermediate | 90 | 60.00% | 25.60% | 2.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217303672 | C -> DEL | N | N | silent_mutation | Average:68.692; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg1217303672 | C -> T | LOC_Os12g29220.1 | intron_variant ; MODIFIER | silent_mutation | Average:68.692; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217303672 | NA | 1.80E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | NA | 1.35E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | NA | 6.74E-07 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | NA | 4.83E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | 6.82E-06 | NA | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | NA | 1.82E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | 5.07E-06 | NA | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | NA | 3.60E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | NA | 4.37E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | 5.08E-07 | NA | mr1226_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217303672 | NA | 9.38E-06 | mr1460_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |