\
| Variant ID: vg1217301806 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17301806 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 77. )
AAAATACTAGTCACACACAAAGTACTATTCATGTATTATCATCTAATAACAATAAAAATACTAATTATAATTATTTCTCAAATAAGAAGAACGGTCAAAC[A/G]
TTGTACATGAACAGTGTTAAAACTACACTTATTTTGGAACGGAGGTAGTAGAAATCCTGCACATATAACTATATAAGGATTCAAAAGTGACGGTTTTAAT
ATTAAAACCGTCACTTTTGAATCCTTATATAGTTATATGTGCAGGATTTCTACTACCTCCGTTCCAAAATAAGTGTAGTTTTAACACTGTTCATGTACAA[T/C]
GTTTGACCGTTCTTCTTATTTGAGAAATAATTATAATTAGTATTTTTATTGTTATTAGATGATAATACATGAATAGTACTTTGTGTGTGACTAGTATTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.80% | 14.60% | 0.74% | 38.85% | NA |
| All Indica | 2759 | 37.50% | 7.50% | 1.01% | 54.01% | NA |
| All Japonica | 1512 | 70.00% | 12.60% | 0.07% | 17.33% | NA |
| Aus | 269 | 8.20% | 81.00% | 0.74% | 10.04% | NA |
| Indica I | 595 | 16.10% | 0.50% | 0.67% | 82.69% | NA |
| Indica II | 465 | 18.50% | 18.30% | 1.29% | 61.94% | NA |
| Indica III | 913 | 61.90% | 4.60% | 0.33% | 33.19% | NA |
| Indica Intermediate | 786 | 36.60% | 9.70% | 1.91% | 51.78% | NA |
| Temperate Japonica | 767 | 96.20% | 0.40% | 0.00% | 3.39% | NA |
| Tropical Japonica | 504 | 31.00% | 30.60% | 0.20% | 38.29% | NA |
| Japonica Intermediate | 241 | 68.00% | 14.10% | 0.00% | 17.84% | NA |
| VI/Aromatic | 96 | 5.20% | 59.40% | 1.04% | 34.38% | NA |
| Intermediate | 90 | 47.80% | 22.20% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217301806 | A -> DEL | N | N | silent_mutation | Average:18.615; most accessible tissue: Callus, score: 58.592 | N | N | N | N |
| vg1217301806 | A -> G | LOC_Os12g29220.1 | downstream_gene_variant ; 267.0bp to feature; MODIFIER | silent_mutation | Average:18.615; most accessible tissue: Callus, score: 58.592 | N | N | N | N |
| vg1217301806 | A -> G | LOC_Os12g29200-LOC_Os12g29220 | intergenic_region ; MODIFIER | silent_mutation | Average:18.615; most accessible tissue: Callus, score: 58.592 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217301806 | NA | 4.12E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217301806 | 5.34E-06 | NA | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217301806 | 6.76E-07 | 7.53E-10 | mr1188 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217301806 | NA | 3.81E-08 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217301806 | NA | 1.53E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |