\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217301806:

Variant ID: vg1217301806 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17301806
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATACTAGTCACACACAAAGTACTATTCATGTATTATCATCTAATAACAATAAAAATACTAATTATAATTATTTCTCAAATAAGAAGAACGGTCAAAC[A/G]
TTGTACATGAACAGTGTTAAAACTACACTTATTTTGGAACGGAGGTAGTAGAAATCCTGCACATATAACTATATAAGGATTCAAAAGTGACGGTTTTAAT

Reverse complement sequence

ATTAAAACCGTCACTTTTGAATCCTTATATAGTTATATGTGCAGGATTTCTACTACCTCCGTTCCAAAATAAGTGTAGTTTTAACACTGTTCATGTACAA[T/C]
GTTTGACCGTTCTTCTTATTTGAGAAATAATTATAATTAGTATTTTTATTGTTATTAGATGATAATACATGAATAGTACTTTGTGTGTGACTAGTATTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.80% 14.60% 0.74% 38.85% NA
All Indica  2759 37.50% 7.50% 1.01% 54.01% NA
All Japonica  1512 70.00% 12.60% 0.07% 17.33% NA
Aus  269 8.20% 81.00% 0.74% 10.04% NA
Indica I  595 16.10% 0.50% 0.67% 82.69% NA
Indica II  465 18.50% 18.30% 1.29% 61.94% NA
Indica III  913 61.90% 4.60% 0.33% 33.19% NA
Indica Intermediate  786 36.60% 9.70% 1.91% 51.78% NA
Temperate Japonica  767 96.20% 0.40% 0.00% 3.39% NA
Tropical Japonica  504 31.00% 30.60% 0.20% 38.29% NA
Japonica Intermediate  241 68.00% 14.10% 0.00% 17.84% NA
VI/Aromatic  96 5.20% 59.40% 1.04% 34.38% NA
Intermediate  90 47.80% 22.20% 3.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217301806 A -> DEL N N silent_mutation Average:18.615; most accessible tissue: Callus, score: 58.592 N N N N
vg1217301806 A -> G LOC_Os12g29220.1 downstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:18.615; most accessible tissue: Callus, score: 58.592 N N N N
vg1217301806 A -> G LOC_Os12g29200-LOC_Os12g29220 intergenic_region ; MODIFIER silent_mutation Average:18.615; most accessible tissue: Callus, score: 58.592 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217301806 NA 4.12E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217301806 5.34E-06 NA mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217301806 6.76E-07 7.53E-10 mr1188 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217301806 NA 3.81E-08 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217301806 NA 1.53E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251