\
| Variant ID: vg1217281529 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17281529 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATTTTTGTGTGCGGTGGTTCCGCCCGTCTGGAATCCATCGTCTGCCAAAATCACGATTTTTTCGTACGGGTGAGGCACCGCCCACGAAAATCGATTTTC[G/A]
CGGTCGGGCGCTTAAGCCGCCCCCACGGTAAAATAAAAAATCAAAACAAAAAAAAGAAAAAACCAAAACCCTAACTGCCGCCGTCGTCGTCGCCCTCTTC
GAAGAGGGCGACGACGACGGCGGCAGTTAGGGTTTTGGTTTTTTCTTTTTTTTGTTTTGATTTTTTATTTTACCGTGGGGGCGGCTTAAGCGCCCGACCG[C/T]
GAAAATCGATTTTCGTGGGCGGTGCCTCACCCGTACGAAAAAATCGTGATTTTGGCAGACGATGGATTCCAGACGGGCGGAACCACCGCACACAAAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 6.60% | 0.17% | 2.20% | NA |
| All Indica | 2759 | 92.10% | 4.10% | 0.25% | 3.55% | NA |
| All Japonica | 1512 | 87.40% | 12.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.00% | 1.86% | NA |
| Indica I | 595 | 97.30% | 0.20% | 0.17% | 2.35% | NA |
| Indica II | 465 | 80.20% | 17.60% | 0.22% | 1.94% | NA |
| Indica III | 913 | 95.60% | 0.40% | 0.11% | 3.83% | NA |
| Indica Intermediate | 786 | 91.00% | 3.40% | 0.51% | 5.09% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.00% | 30.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217281529 | G -> DEL | N | N | silent_mutation | Average:53.502; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg1217281529 | G -> A | LOC_Os12g29190.1 | upstream_gene_variant ; 2277.0bp to feature; MODIFIER | silent_mutation | Average:53.502; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg1217281529 | G -> A | LOC_Os12g29180-LOC_Os12g29190 | intergenic_region ; MODIFIER | silent_mutation | Average:53.502; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217281529 | NA | 8.17E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | NA | 3.17E-07 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | NA | 8.50E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | NA | 1.15E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | NA | 2.34E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 2.46E-06 | NA | mr1022_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 9.22E-08 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 2.97E-08 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 8.46E-08 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 1.63E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 9.77E-06 | NA | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 7.05E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 5.56E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 3.31E-10 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 5.92E-06 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 5.19E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 4.55E-06 | NA | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 9.67E-08 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 2.40E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | 2.17E-07 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217281529 | NA | 3.80E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |