\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217279515:

Variant ID: vg1217279515 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17279515
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATAGATTCATCGGTTTATAAGTTATAACGGATGGTCAGATTTTTTTTTCTTTTTTCTCATAATTTCAAAGATTTTTTCTAATTTATTAGAGTGCGAC[A/G]
TGACAGCTTAGGAGAGTATATAGGATGTCACGTGGTGACTAAAGTGCATTCGTAGGAAGTTTAATGGACTTGTGCGTAGAATACAACTTGAAATAACATT

Reverse complement sequence

AATGTTATTTCAAGTTGTATTCTACGCACAAGTCCATTAAACTTCCTACGAATGCACTTTAGTCACCACGTGACATCCTATATACTCTCCTAAGCTGTCA[T/C]
GTCGCACTCTAATAAATTAGAAAAAATCTTTGAAATTATGAGAAAAAAGAAAAAAAAATCTGACCATCCGTTATAACTTATAAACCGATGAATCTATTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 6.50% 10.52% 0.17% NA
All Indica  2759 75.90% 7.00% 16.82% 0.29% NA
All Japonica  1512 92.70% 6.00% 1.39% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 88.60% 3.20% 8.07% 0.17% NA
Indica II  465 89.50% 9.00% 1.51% 0.00% NA
Indica III  913 55.60% 11.00% 32.97% 0.44% NA
Indica Intermediate  786 81.80% 4.10% 13.74% 0.38% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 80.20% 16.30% 3.57% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.83% 0.00% NA
VI/Aromatic  96 81.20% 14.60% 4.17% 0.00% NA
Intermediate  90 78.90% 13.30% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217279515 A -> DEL N N silent_mutation Average:7.909; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1217279515 A -> G LOC_Os12g29180.1 upstream_gene_variant ; 3765.0bp to feature; MODIFIER silent_mutation Average:7.909; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1217279515 A -> G LOC_Os12g29190.1 upstream_gene_variant ; 4291.0bp to feature; MODIFIER silent_mutation Average:7.909; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1217279515 A -> G LOC_Os12g29180-LOC_Os12g29190 intergenic_region ; MODIFIER silent_mutation Average:7.909; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217279515 4.44E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217279515 9.58E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217279515 6.97E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217279515 4.89E-07 NA mr1264_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251