Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217241436:

Variant ID: vg1217241436 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17241436
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAATAGAGCCTCTTATAATTCAGCTCAACCTTGGAAGTGTGTGTGTGAAGTGAGGGAGTGAAGCCTTTATATAGAGGTAGGTATGACGGTTGGCGAAGA[G/C]
GAAATGTCCGAAGTGCCCTCCAACCGCCATCAGGGATGCATCTGGAACGTCCACGCCAAACCCCACATCCAATGGTGGAGATAGTGGTTCCGCCGAACCT

Reverse complement sequence

AGGTTCGGCGGAACCACTATCTCCACCATTGGATGTGGGGTTTGGCGTGGACGTTCCAGATGCATCCCTGATGGCGGTTGGAGGGCACTTCGGACATTTC[C/G]
TCTTCGCCAACCGTCATACCTACCTCTATATAAAGGCTTCACTCCCTCACTTCACACACACACTTCCAAGGTTGAGCTGAATTATAAGAGGCTCTATTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.90%	5.10%	1.84%	20.21%	NA
All Indica	2759	64.20%	2.20%	2.97%	30.59%	NA
All Japonica	1512	84.80%	9.60%	0.07%	5.56%	NA
Aus	269	94.40%	0.40%	0.74%	4.46%	NA
Indica I	595	21.80%	0.00%	5.04%	73.11%	NA
Indica II	465	78.10%	9.00%	1.51%	11.40%	NA
Indica III	913	79.00%	0.80%	2.63%	17.63%	NA
Indica Intermediate	786	71.00%	1.50%	2.67%	24.81%	NA
Temperate Japonica	767	97.50%	0.10%	0.00%	2.35%	NA
Tropical Japonica	504	65.50%	26.20%	0.20%	8.13%	NA
Japonica Intermediate	241	84.60%	5.00%	0.00%	10.37%	NA
VI/Aromatic	96	68.80%	21.90%	1.04%	8.33%	NA
Intermediate	90	78.90%	12.20%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217241436	G -> C	LOC_Os12g29120.1	upstream_gene_variant ; 3356.0bp to feature; MODIFIER	silent_mutation	Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1217241436	G -> C	LOC_Os12g29130.1	downstream_gene_variant ; 3324.0bp to feature; MODIFIER	silent_mutation	Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1217241436	G -> C	LOC_Os12g29120-LOC_Os12g29130	intergenic_region ; MODIFIER	silent_mutation	Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1217241436	G -> DEL	N	N	silent_mutation	Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217241436	NA	6.90E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436	NA	4.88E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436	NA	1.31E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436	NA	4.67E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436	3.89E-07	3.03E-10	mr1471	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436	NA	6.86E-08	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436	3.22E-06	3.22E-06	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436	NA	1.59E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436	NA	4.07E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251