\
| Variant ID: vg1217241436 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17241436 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACAATAGAGCCTCTTATAATTCAGCTCAACCTTGGAAGTGTGTGTGTGAAGTGAGGGAGTGAAGCCTTTATATAGAGGTAGGTATGACGGTTGGCGAAGA[G/C]
GAAATGTCCGAAGTGCCCTCCAACCGCCATCAGGGATGCATCTGGAACGTCCACGCCAAACCCCACATCCAATGGTGGAGATAGTGGTTCCGCCGAACCT
AGGTTCGGCGGAACCACTATCTCCACCATTGGATGTGGGGTTTGGCGTGGACGTTCCAGATGCATCCCTGATGGCGGTTGGAGGGCACTTCGGACATTTC[C/G]
TCTTCGCCAACCGTCATACCTACCTCTATATAAAGGCTTCACTCCCTCACTTCACACACACACTTCCAAGGTTGAGCTGAATTATAAGAGGCTCTATTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 5.10% | 1.84% | 20.21% | NA |
| All Indica | 2759 | 64.20% | 2.20% | 2.97% | 30.59% | NA |
| All Japonica | 1512 | 84.80% | 9.60% | 0.07% | 5.56% | NA |
| Aus | 269 | 94.40% | 0.40% | 0.74% | 4.46% | NA |
| Indica I | 595 | 21.80% | 0.00% | 5.04% | 73.11% | NA |
| Indica II | 465 | 78.10% | 9.00% | 1.51% | 11.40% | NA |
| Indica III | 913 | 79.00% | 0.80% | 2.63% | 17.63% | NA |
| Indica Intermediate | 786 | 71.00% | 1.50% | 2.67% | 24.81% | NA |
| Temperate Japonica | 767 | 97.50% | 0.10% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 65.50% | 26.20% | 0.20% | 8.13% | NA |
| Japonica Intermediate | 241 | 84.60% | 5.00% | 0.00% | 10.37% | NA |
| VI/Aromatic | 96 | 68.80% | 21.90% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 78.90% | 12.20% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217241436 | G -> C | LOC_Os12g29120.1 | upstream_gene_variant ; 3356.0bp to feature; MODIFIER | silent_mutation | Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1217241436 | G -> C | LOC_Os12g29130.1 | downstream_gene_variant ; 3324.0bp to feature; MODIFIER | silent_mutation | Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1217241436 | G -> C | LOC_Os12g29120-LOC_Os12g29130 | intergenic_region ; MODIFIER | silent_mutation | Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1217241436 | G -> DEL | N | N | silent_mutation | Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217241436 | NA | 6.90E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217241436 | NA | 4.88E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217241436 | NA | 1.31E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217241436 | NA | 4.67E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217241436 | 3.89E-07 | 3.03E-10 | mr1471 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217241436 | NA | 6.86E-08 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217241436 | 3.22E-06 | 3.22E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217241436 | NA | 1.59E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217241436 | NA | 4.07E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |