\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217241436:

Variant ID: vg1217241436 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17241436
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAATAGAGCCTCTTATAATTCAGCTCAACCTTGGAAGTGTGTGTGTGAAGTGAGGGAGTGAAGCCTTTATATAGAGGTAGGTATGACGGTTGGCGAAGA[G/C]
GAAATGTCCGAAGTGCCCTCCAACCGCCATCAGGGATGCATCTGGAACGTCCACGCCAAACCCCACATCCAATGGTGGAGATAGTGGTTCCGCCGAACCT

Reverse complement sequence

AGGTTCGGCGGAACCACTATCTCCACCATTGGATGTGGGGTTTGGCGTGGACGTTCCAGATGCATCCCTGATGGCGGTTGGAGGGCACTTCGGACATTTC[C/G]
TCTTCGCCAACCGTCATACCTACCTCTATATAAAGGCTTCACTCCCTCACTTCACACACACACTTCCAAGGTTGAGCTGAATTATAAGAGGCTCTATTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 5.10% 1.84% 20.21% NA
All Indica  2759 64.20% 2.20% 2.97% 30.59% NA
All Japonica  1512 84.80% 9.60% 0.07% 5.56% NA
Aus  269 94.40% 0.40% 0.74% 4.46% NA
Indica I  595 21.80% 0.00% 5.04% 73.11% NA
Indica II  465 78.10% 9.00% 1.51% 11.40% NA
Indica III  913 79.00% 0.80% 2.63% 17.63% NA
Indica Intermediate  786 71.00% 1.50% 2.67% 24.81% NA
Temperate Japonica  767 97.50% 0.10% 0.00% 2.35% NA
Tropical Japonica  504 65.50% 26.20% 0.20% 8.13% NA
Japonica Intermediate  241 84.60% 5.00% 0.00% 10.37% NA
VI/Aromatic  96 68.80% 21.90% 1.04% 8.33% NA
Intermediate  90 78.90% 12.20% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217241436 G -> C LOC_Os12g29120.1 upstream_gene_variant ; 3356.0bp to feature; MODIFIER silent_mutation Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1217241436 G -> C LOC_Os12g29130.1 downstream_gene_variant ; 3324.0bp to feature; MODIFIER silent_mutation Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1217241436 G -> C LOC_Os12g29120-LOC_Os12g29130 intergenic_region ; MODIFIER silent_mutation Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1217241436 G -> DEL N N silent_mutation Average:23.858; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217241436 NA 6.90E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436 NA 4.88E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436 NA 1.31E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436 NA 4.67E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436 3.89E-07 3.03E-10 mr1471 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436 NA 6.86E-08 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436 3.22E-06 3.22E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436 NA 1.59E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217241436 NA 4.07E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251