Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217240367:

Variant ID: vg1217240367 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17240367
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCTGGACAACGACTTGAGGACGTTCTTCACCGTTGCCAGAGTTAGCCTAGATATGCCCCTATGCATCTACCAGATCTACATGTGAAGGGGCATGAGGA[A/T]
GCAGATAACTAAGGTGACGTTGCATCCTTTCGCCATAGCTCGAGGTCTAGCATGATGATAAAGTCACTATTCTAGGGATTAGAGTTGGCGGCATGTTCTT

Reverse complement sequence

AAGAACATGCCGCCAACTCTAATCCCTAGAATAGTGACTTTATCATCATGCTAGACCTCGAGCTATGGCGAAAGGATGCAACGTCACCTTAGTTATCTGC[T/A]
TCCTCATGCCCCTTCACATGTAGATCTGGTAGATGCATAGGGGCATATCTAGGCTAACTCTGGCAACGGTGAAGAACGTCCTCAAGTCGTTGTCCAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.50%	20.10%	5.35%	1.99%	NA
All Indica	2759	60.80%	27.40%	8.48%	3.33%	NA
All Japonica	1512	89.90%	9.50%	0.53%	0.00%	NA
Aus	269	97.80%	0.70%	1.12%	0.37%	NA
Indica I	595	65.40%	11.30%	16.97%	6.39%	NA
Indica II	465	83.20%	12.30%	2.80%	1.72%	NA
Indica III	913	42.60%	50.30%	4.93%	2.19%	NA
Indica Intermediate	786	65.30%	21.90%	9.54%	3.31%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	73.20%	25.60%	1.19%	0.00%	NA
Japonica Intermediate	241	94.20%	5.00%	0.83%	0.00%	NA
VI/Aromatic	96	67.70%	26.00%	5.21%	1.04%	NA
Intermediate	90	67.80%	28.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217240367	A -> DEL	N	N	silent_mutation	Average:33.277; most accessible tissue: Minghui63 young leaf, score: 77.243	N	N	N	N
vg1217240367	A -> T	LOC_Os12g29120.1	upstream_gene_variant ; 2287.0bp to feature; MODIFIER	silent_mutation	Average:33.277; most accessible tissue: Minghui63 young leaf, score: 77.243	N	N	N	N
vg1217240367	A -> T	LOC_Os12g29130.1	downstream_gene_variant ; 4393.0bp to feature; MODIFIER	silent_mutation	Average:33.277; most accessible tissue: Minghui63 young leaf, score: 77.243	N	N	N	N
vg1217240367	A -> T	LOC_Os12g29120-LOC_Os12g29130	intergenic_region ; MODIFIER	silent_mutation	Average:33.277; most accessible tissue: Minghui63 young leaf, score: 77.243	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217240367	NA	4.85E-07	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	1.25E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	1.58E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	2.09E-08	5.72E-11	mr1083	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	6.97E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	3.87E-07	3.89E-09	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	4.70E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	5.12E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	4.75E-06	NA	mr1437	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	2.81E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	9.56E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	6.45E-06	mr1653	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	3.26E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	1.08E-09	1.08E-09	mr1076_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	1.71E-06	2.97E-10	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	4.47E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	1.61E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	6.86E-08	1.83E-09	mr1104_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	2.56E-07	1.16E-08	mr1107_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	6.51E-07	2.59E-10	mr1226_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	7.83E-07	7.83E-07	mr1264_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217240367	NA	5.88E-08	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251