\
| Variant ID: vg1217218651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17218651 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACATTTATTAGTAAAAATTTATGTGCAGAATTCAGAACCAAGTTGATAGAGCTCTTAAAAGAATTTAGAGATTGCTTTACTTGGGAATATTATGAAATGC[C/T]
AGGACTCAGCCGATCGATTGTTGAACATCGGCTACCTATCAAACCCGGGGTTAGACCACATCAGCAACCGCCAAGAAGATGCAAAGCCGATATGCTGGAG
CTCCAGCATATCGGCTTTGCATCTTCTTGGCGGTTGCTGATGTGGTCTAACCCCGGGTTTGATAGGTAGCCGATGTTCAACAATCGATCGGCTGAGTCCT[G/A]
GCATTTCATAATATTCCCAAGTAAAGCAATCTCTAAATTCTTTTAAGAGCTCTATCAACTTGGTTCTGAATTCTGCACATAAATTTTTACTAATAAATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 3.80% | 0.40% | 1.08% | NA |
| All Indica | 2759 | 98.20% | 0.20% | 0.43% | 1.20% | NA |
| All Japonica | 1512 | 87.20% | 11.20% | 0.46% | 1.19% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.50% | 0.20% | 0.86% | 3.44% | NA |
| Indica III | 913 | 98.50% | 0.20% | 0.55% | 0.77% | NA |
| Indica Intermediate | 786 | 98.20% | 0.30% | 0.25% | 1.27% | NA |
| Temperate Japonica | 767 | 98.20% | 0.40% | 0.39% | 1.04% | NA |
| Tropical Japonica | 504 | 70.00% | 29.40% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 88.00% | 7.50% | 0.83% | 3.73% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217218651 | C -> DEL | LOC_Os12g29070.1 | N | frameshift_variant | Average:32.312; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
| vg1217218651 | C -> T | LOC_Os12g29070.1 | missense_variant ; p.Pro1154Leu; MODERATE | nonsynonymous_codon ; P1154L | Average:32.312; most accessible tissue: Minghui63 flag leaf, score: 55.781 | benign |
0.243 |
DELETERIOUS | 0.02 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217218651 | NA | 8.73E-06 | mr1215 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217218651 | 1.58E-06 | 1.21E-08 | mr1218 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217218651 | NA | 2.44E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217218651 | NA | 7.96E-06 | mr1398 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217218651 | 3.15E-06 | 2.35E-09 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217218651 | 5.18E-08 | 1.31E-12 | mr1583 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217218651 | NA | 1.60E-06 | mr1607 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217218651 | NA | 8.92E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217218651 | 6.75E-06 | 1.33E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |