Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217212698:

Variant ID: vg1217212698 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17212698
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTATAAGGATTATATATCATTGATATCTATAGCCGATCGGGTAGATTTAGTTCCGACTTGTTTCCTTAACAATTGTCGATCGATTCACATATGACATC[G/A]
GCTCAAAGATAAATGATATGTCATCAGCATCTAGCCGATCGGCTATCATTTATGGATTTAATCACGGTTTCTTTGTCTTTGTTTCTTGTTGATTGCAGGA

Reverse complement sequence

TCCTGCAATCAACAAGAAACAAAGACAAAGAAACCGTGATTAAATCCATAAATGATAGCCGATCGGCTAGATGCTGATGACATATCATTTATCTTTGAGC[C/T]
GATGTCATATGTGAATCGATCGACAATTGTTAAGGAAACAAGTCGGAACTAAATCTACCCGATCGGCTATAGATATCAATGATATATAATCCTTATACCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.50%	24.90%	1.54%	9.08%	NA
All Indica	2759	51.80%	34.10%	2.50%	11.63%	NA
All Japonica	1512	80.50%	12.80%	0.00%	6.68%	NA
Aus	269	93.30%	5.60%	0.00%	1.12%	NA
Indica I	595	18.00%	76.80%	0.84%	4.37%	NA
Indica II	465	55.50%	14.00%	6.02%	24.52%	NA
Indica III	913	70.20%	20.60%	1.20%	8.00%	NA
Indica Intermediate	786	53.70%	29.40%	3.18%	13.74%	NA
Temperate Japonica	767	96.50%	0.80%	0.00%	2.74%	NA
Tropical Japonica	504	58.30%	31.00%	0.00%	10.71%	NA
Japonica Intermediate	241	75.90%	13.30%	0.00%	10.79%	NA
VI/Aromatic	96	88.50%	10.40%	0.00%	1.04%	NA
Intermediate	90	75.60%	16.70%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217212698	G -> DEL	N	N	silent_mutation	Average:23.781; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg1217212698	G -> A	LOC_Os12g29060.1	upstream_gene_variant ; 4033.0bp to feature; MODIFIER	silent_mutation	Average:23.781; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg1217212698	G -> A	LOC_Os12g29070.1	intron_variant ; MODIFIER	silent_mutation	Average:23.781; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217212698	NA	3.58E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	3.17E-06	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	4.81E-07	NA	mr1422	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	4.87E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	2.72E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	1.26E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	1.11E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	2.14E-08	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	9.88E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	4.21E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	7.91E-06	NA	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	9.69E-10	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217212698	NA	7.68E-07	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251