\
| Variant ID: vg1217212698 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17212698 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )
CGGTATAAGGATTATATATCATTGATATCTATAGCCGATCGGGTAGATTTAGTTCCGACTTGTTTCCTTAACAATTGTCGATCGATTCACATATGACATC[G/A]
GCTCAAAGATAAATGATATGTCATCAGCATCTAGCCGATCGGCTATCATTTATGGATTTAATCACGGTTTCTTTGTCTTTGTTTCTTGTTGATTGCAGGA
TCCTGCAATCAACAAGAAACAAAGACAAAGAAACCGTGATTAAATCCATAAATGATAGCCGATCGGCTAGATGCTGATGACATATCATTTATCTTTGAGC[C/T]
GATGTCATATGTGAATCGATCGACAATTGTTAAGGAAACAAGTCGGAACTAAATCTACCCGATCGGCTATAGATATCAATGATATATAATCCTTATACCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.50% | 24.90% | 1.54% | 9.08% | NA |
| All Indica | 2759 | 51.80% | 34.10% | 2.50% | 11.63% | NA |
| All Japonica | 1512 | 80.50% | 12.80% | 0.00% | 6.68% | NA |
| Aus | 269 | 93.30% | 5.60% | 0.00% | 1.12% | NA |
| Indica I | 595 | 18.00% | 76.80% | 0.84% | 4.37% | NA |
| Indica II | 465 | 55.50% | 14.00% | 6.02% | 24.52% | NA |
| Indica III | 913 | 70.20% | 20.60% | 1.20% | 8.00% | NA |
| Indica Intermediate | 786 | 53.70% | 29.40% | 3.18% | 13.74% | NA |
| Temperate Japonica | 767 | 96.50% | 0.80% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 58.30% | 31.00% | 0.00% | 10.71% | NA |
| Japonica Intermediate | 241 | 75.90% | 13.30% | 0.00% | 10.79% | NA |
| VI/Aromatic | 96 | 88.50% | 10.40% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 75.60% | 16.70% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217212698 | G -> DEL | N | N | silent_mutation | Average:23.781; most accessible tissue: Minghui63 flag leaf, score: 35.078 | N | N | N | N |
| vg1217212698 | G -> A | LOC_Os12g29060.1 | upstream_gene_variant ; 4033.0bp to feature; MODIFIER | silent_mutation | Average:23.781; most accessible tissue: Minghui63 flag leaf, score: 35.078 | N | N | N | N |
| vg1217212698 | G -> A | LOC_Os12g29070.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.781; most accessible tissue: Minghui63 flag leaf, score: 35.078 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217212698 | NA | 3.58E-07 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 3.17E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | 4.81E-07 | NA | mr1422 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 4.87E-07 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 2.72E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 1.26E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 1.11E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 2.14E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 9.88E-07 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 4.21E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | 7.91E-06 | NA | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 9.69E-10 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217212698 | NA | 7.68E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |