Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217198477:

Variant ID: vg1217198477 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17198477
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTGCATGTCTAAGGGTTTATGAGATGCGGGCGTGCCTATCAGTTTGATCATGCAACTGACAAGATATAGAAATAGTAGATTAATGAGCCGATCGGCTG[G/A]
CAAGCCGATGAAGTAAGTCCAGCCGATGCCGATACTAGACGATAGTGAAAGGATTTTGAGCTATCGGCTATATGATTGATGTAGAATCTGACACTTGATG

Reverse complement sequence

CATCAAGTGTCAGATTCTACATCAATCATATAGCCGATAGCTCAAAATCCTTTCACTATCGTCTAGTATCGGCATCGGCTGGACTTACTTCATCGGCTTG[C/T]
CAGCCGATCGGCTCATTAATCTACTATTTCTATATCTTGTCAGTTGCATGATCAAACTGATAGGCACGCCCGCATCTCATAAACCCTTAGACATGCACTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 23.70% 0.04% 3.07% NA
All Indica  2759 95.90% 2.50% 0.00% 1.67% NA
All Japonica  1512 27.20% 66.40% 0.07% 6.35% NA
Aus  269 91.40% 8.20% 0.00% 0.37% NA
Indica I  595 94.10% 2.70% 0.00% 3.19% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 97.60% 0.20% 0.00% 2.19% NA
Indica Intermediate  786 94.30% 4.80% 0.00% 0.89% NA
Temperate Japonica  767 6.90% 90.70% 0.00% 2.35% NA
Tropical Japonica  504 59.90% 29.60% 0.20% 10.32% NA
Japonica Intermediate  241 23.20% 66.00% 0.00% 10.79% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 66.70% 30.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217198477 G -> DEL N N silent_mutation Average:49.546; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg1217198477 G -> A LOC_Os12g29040.1 upstream_gene_variant ; 1197.0bp to feature; MODIFIER silent_mutation Average:49.546; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg1217198477 G -> A LOC_Os12g29050.1 upstream_gene_variant ; 1533.0bp to feature; MODIFIER silent_mutation Average:49.546; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg1217198477 G -> A LOC_Os12g29040-LOC_Os12g29050 intergenic_region ; MODIFIER silent_mutation Average:49.546; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217198477 NA 1.87E-46 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 9.97E-40 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 3.50E-06 6.14E-32 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 4.41E-08 1.56E-71 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.63E-39 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 4.44E-06 1.82E-54 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 5.82E-07 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 3.88E-09 3.38E-74 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 3.21E-56 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.17E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 2.89E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 3.77E-13 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 8.62E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.57E-18 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 6.54E-85 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 6.15E-55 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 2.64E-07 4.31E-74 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.42E-54 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 1.44E-08 1.08E-73 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 6.09E-14 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 7.38E-12 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.59E-06 mr1658 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 3.56E-14 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 6.96E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 1.27E-06 2.14E-46 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 1.25E-07 7.98E-89 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 6.72E-06 7.37E-66 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 8.87E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 4.02E-15 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 2.67E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 2.12E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 3.44E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 8.87E-13 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 7.12E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 5.37E-07 1.97E-86 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 2.29E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.22E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.38E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 4.39E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.15E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 2.07E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 3.62E-13 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 1.61E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 4.20E-06 2.09E-76 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 3.41E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 2.21E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198477 NA 7.65E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251