\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217175426:

Variant ID: vg1217175426 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17175426
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCCGTGGTATGAGGAGGTTTGGGATGTCTGGCAAGTTAGCACCCCGCTACATCGGCCCCTACCTCACAACCGCCAGACGTGGCGAAGTGGCTTATCAG[T/C]
TTGAGTTACCTGAAGGTCTCACAGATGTGCACAACGTGTTCCACGTATCCCAGTTAAAGAAATGTCTTTGAGTTCCAGAAGAACAAGTTCCCCTGGGTAA

Reverse complement sequence

TTACCCAGGGGAACTTGTTCTTCTGGAACTCAAAGACATTTCTTTAACTGGGATACGTGGAACACGTTGTGCACATCTGTGAGACCTTCAGGTAACTCAA[A/G]
CTGATAAGCCACTTCGCCACGTCTGGCGGTTGTGAGGTAGGGGCCGATGTAGCGGGGTGCTAACTTGCCAGACATCCCAAACCTCCTCATACCACGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 25.40% 0.38% 18.62% NA
All Indica  2759 78.30% 3.20% 0.29% 18.19% NA
All Japonica  1512 23.70% 69.60% 0.07% 6.61% NA
Aus  269 8.90% 9.30% 2.60% 79.18% NA
Indica I  595 92.30% 3.20% 0.00% 4.54% NA
Indica II  465 67.30% 2.60% 0.00% 30.11% NA
Indica III  913 80.30% 0.80% 0.55% 18.40% NA
Indica Intermediate  786 72.00% 6.40% 0.38% 21.25% NA
Temperate Japonica  767 1.60% 96.20% 0.00% 2.22% NA
Tropical Japonica  504 59.10% 30.20% 0.00% 10.71% NA
Japonica Intermediate  241 19.90% 67.60% 0.41% 12.03% NA
VI/Aromatic  96 41.70% 1.00% 2.08% 55.21% NA
Intermediate  90 51.10% 35.60% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217175426 T -> C LOC_Os12g29020.1 intron_variant ; MODIFIER silent_mutation Average:20.221; most accessible tissue: Callus, score: 41.735 N N N N
vg1217175426 T -> DEL N N silent_mutation Average:20.221; most accessible tissue: Callus, score: 41.735 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217175426 8.32E-06 NA mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 1.65E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 8.79E-06 NA mr1190 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 5.45E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 2.26E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 7.59E-06 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 3.64E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 1.41E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 5.66E-19 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 1.08E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 1.32E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 2.31E-25 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 2.16E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 1.70E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 1.93E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 6.96E-18 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 6.21E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 7.00E-06 NA mr1637 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 8.75E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 6.94E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 8.88E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 7.74E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 4.39E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 3.74E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 4.86E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 1.03E-06 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 5.53E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 8.00E-17 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 1.02E-16 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 4.68E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 3.99E-17 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 3.38E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175426 NA 2.86E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251