\
| Variant ID: vg1217121743 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17121743 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.01, others allele: 0.00, population size: 236. )
TTGATGAAAGTTACTCAAAGCATTCCAAATTTCATGAGCAGCTCAAAAATGCGCAACACGATCATAATCCGAACGAGAAATACCACTCAAAAGAATGTTG[T/C]
GAGCTTTGCAATTTTGTTCAAAAGCAGTTTTTTCAGCAGCAGTATTAATAGCTTCAGGAATCACATAGGGACGAGAAACTTTTCTCCAAATATCATAAAC
GTTTATGATATTTGGAGAAAAGTTTCTCGTCCCTATGTGATTCCTGAAGCTATTAATACTGCTGCTGAAAAAACTGCTTTTGAACAAAATTGCAAAGCTC[A/G]
CAACATTCTTTTGAGTGGTATTTCTCGTTCGGATTATGATCGTGTTGCGCATTTTTGAGCTGCTCATGAAATTTGGAATGCTTTGAGTAACTTTCATCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 6.70% | 0.11% | 2.84% | NA |
| All Indica | 2759 | 97.20% | 1.30% | 0.07% | 1.45% | NA |
| All Japonica | 1512 | 93.70% | 0.20% | 0.20% | 5.95% | NA |
| Aus | 269 | 18.60% | 81.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 97.10% | 0.00% | 0.17% | 2.69% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.70% | 1.30% | 0.00% | 1.97% | NA |
| Indica Intermediate | 786 | 96.30% | 2.80% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 90.10% | 0.00% | 0.60% | 9.33% | NA |
| Japonica Intermediate | 241 | 88.40% | 1.20% | 0.00% | 10.37% | NA |
| VI/Aromatic | 96 | 41.70% | 58.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217121743 | T -> C | LOC_Os12g28950.1 | missense_variant ; p.His46Arg; MODERATE | nonsynonymous_codon ; H46R | Average:23.195; most accessible tissue: Minghui63 flag leaf, score: 32.882 | unknown | unknown | TOLERATED | 1.00 |
| vg1217121743 | T -> DEL | LOC_Os12g28950.1 | N | frameshift_variant | Average:23.195; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217121743 | NA | 8.37E-10 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | 2.70E-06 | NA | mr1741 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 7.96E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 9.78E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 1.32E-10 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 1.74E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 3.91E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 3.59E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 1.73E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 2.57E-08 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 1.58E-07 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 3.61E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217121743 | NA | 3.58E-10 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |