Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217121268:

Variant ID: vg1217121268 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17121268
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.29, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TGAACTCTTCGGCTTGTTGTTGTTGGTCTTCTCACCATCTTTGTCTTCTCTTTTGCCTCTCCCAAGCTTAGGACAATGCGAACGAAGATGATCAATTGAA[C/T]
CACGCATTCAAAGCAACGATTTGGACCACCTCTTTTCATGTTCCTGGCATTATTCATAGCTCGAGAAATTCTGTTAGCAACCAAAGCCAAATCCTCCTCC

Reverse complement sequence

GGAGGAGGATTTGGCTTTGGTTGCTAACAGAATTTCTCGAGCTATGAATAATGCCAGGAACATGAAAAGAGGTGGTCCAAATCGTTGCTTTGAATGCGTG[G/A]
TTCAATTGATCATCTTCGTTCGCATTGTCCTAAGCTTGGGAGAGGCAAAAGAGAAGACAAAGATGGTGAGAAGACCAACAACAACAAGCCGAAGAGTTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	41.70%	0.00%	3.05%	NA
All Indica	2759	78.00%	20.30%	0.00%	1.63%	NA
All Japonica	1512	23.60%	70.00%	0.00%	6.35%	NA
Aus	269	7.10%	92.90%	0.00%	0.00%	NA
Indica I	595	92.60%	4.20%	0.00%	3.19%	NA
Indica II	465	66.50%	33.50%	0.00%	0.00%	NA
Indica III	913	79.60%	18.30%	0.00%	2.08%	NA
Indica Intermediate	786	72.00%	27.10%	0.00%	0.89%	NA
Temperate Japonica	767	1.60%	96.10%	0.00%	2.35%	NA
Tropical Japonica	504	59.30%	30.40%	0.00%	10.32%	NA
Japonica Intermediate	241	19.10%	70.10%	0.00%	10.79%	NA
VI/Aromatic	96	38.50%	61.50%	0.00%	0.00%	NA
Intermediate	90	51.10%	45.60%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217121268	C -> DEL	N	N	silent_mutation	Average:25.788; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg1217121268	C -> T	LOC_Os12g28960.1	upstream_gene_variant ; 4883.0bp to feature; MODIFIER	silent_mutation	Average:25.788; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg1217121268	C -> T	LOC_Os12g28940.1	downstream_gene_variant ; 4504.0bp to feature; MODIFIER	silent_mutation	Average:25.788; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg1217121268	C -> T	LOC_Os12g28950.1	intron_variant ; MODIFIER	silent_mutation	Average:25.788; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217121268	1.63E-06	3.80E-09	mr1174	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217121268	NA	8.85E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217121268	NA	6.75E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217121268	NA	1.10E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217121268	NA	1.41E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217121268	NA	2.14E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217121268	NA	7.20E-08	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217121268	NA	6.79E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251