\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217108652:

Variant ID: vg1217108652 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17108652
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GTCATCACAGAAACAATAGGAGTATATGAAGAAGCAACCATCTTAGCATGACGACACGGTGTACAAACCAAATCAAGATCTTTCTTAAGTTTAGGCAAAC[C/T]
ACGAACAAGATCCAAACCACTTAACCTAGTGAGATGATCAAAACCAACATGTTCAAGTCTAAGATGCCAAAACATCACATCTTTATCAAACCTAGCAACC

Reverse complement sequence

GGTTGCTAGGTTTGATAAAGATGTGATGTTTTGGCATCTTAGACTTGAACATGTTGGTTTTGATCATCTCACTAGGTTAAGTGGTTTGGATCTTGTTCGT[G/A]
GTTTGCCTAAACTTAAGAAAGATCTTGATTTGGTTTGTACACCGTGTCGTCATGCTAAGATGGTTGCTTCTTCATATACTCCTATTGTTTCTGTGATGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 20.70% 1.02% 22.18% NA
All Indica  2759 37.30% 27.90% 1.63% 33.13% NA
All Japonica  1512 82.90% 10.30% 0.07% 6.68% NA
Aus  269 93.30% 0.70% 0.00% 5.95% NA
Indica I  595 8.70% 12.30% 2.52% 76.47% NA
Indica II  465 73.50% 13.10% 1.29% 12.04% NA
Indica III  913 27.70% 50.10% 0.88% 21.36% NA
Indica Intermediate  786 48.70% 22.80% 2.04% 26.46% NA
Temperate Japonica  767 96.90% 0.40% 0.00% 2.74% NA
Tropical Japonica  504 61.90% 27.60% 0.20% 10.32% NA
Japonica Intermediate  241 82.60% 5.80% 0.00% 11.62% NA
VI/Aromatic  96 62.50% 28.10% 1.04% 8.33% NA
Intermediate  90 63.30% 25.60% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217108652 C -> DEL LOC_Os12g28930.1 N frameshift_variant Average:18.218; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg1217108652 C -> T LOC_Os12g28930.1 missense_variant ; p.Gly71Ser; MODERATE nonsynonymous_codon ; G71S Average:18.218; most accessible tissue: Minghui63 young leaf, score: 29.964 possibly damaging 1.834 TOLERATED 0.25

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217108652 NA 6.01E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 4.08E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 3.64E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 3.30E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 4.04E-06 NA mr1034 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 9.70E-07 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 1.19E-07 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 4.90E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 1.25E-06 mr1154 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 5.07E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 5.94E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217108652 NA 8.89E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251