\
| Variant ID: vg1217108652 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17108652 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )
GTCATCACAGAAACAATAGGAGTATATGAAGAAGCAACCATCTTAGCATGACGACACGGTGTACAAACCAAATCAAGATCTTTCTTAAGTTTAGGCAAAC[C/T]
ACGAACAAGATCCAAACCACTTAACCTAGTGAGATGATCAAAACCAACATGTTCAAGTCTAAGATGCCAAAACATCACATCTTTATCAAACCTAGCAACC
GGTTGCTAGGTTTGATAAAGATGTGATGTTTTGGCATCTTAGACTTGAACATGTTGGTTTTGATCATCTCACTAGGTTAAGTGGTTTGGATCTTGTTCGT[G/A]
GTTTGCCTAAACTTAAGAAAGATCTTGATTTGGTTTGTACACCGTGTCGTCATGCTAAGATGGTTGCTTCTTCATATACTCCTATTGTTTCTGTGATGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 20.70% | 1.02% | 22.18% | NA |
| All Indica | 2759 | 37.30% | 27.90% | 1.63% | 33.13% | NA |
| All Japonica | 1512 | 82.90% | 10.30% | 0.07% | 6.68% | NA |
| Aus | 269 | 93.30% | 0.70% | 0.00% | 5.95% | NA |
| Indica I | 595 | 8.70% | 12.30% | 2.52% | 76.47% | NA |
| Indica II | 465 | 73.50% | 13.10% | 1.29% | 12.04% | NA |
| Indica III | 913 | 27.70% | 50.10% | 0.88% | 21.36% | NA |
| Indica Intermediate | 786 | 48.70% | 22.80% | 2.04% | 26.46% | NA |
| Temperate Japonica | 767 | 96.90% | 0.40% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 61.90% | 27.60% | 0.20% | 10.32% | NA |
| Japonica Intermediate | 241 | 82.60% | 5.80% | 0.00% | 11.62% | NA |
| VI/Aromatic | 96 | 62.50% | 28.10% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 63.30% | 25.60% | 1.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217108652 | C -> DEL | LOC_Os12g28930.1 | N | frameshift_variant | Average:18.218; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
| vg1217108652 | C -> T | LOC_Os12g28930.1 | missense_variant ; p.Gly71Ser; MODERATE | nonsynonymous_codon ; G71S | Average:18.218; most accessible tissue: Minghui63 young leaf, score: 29.964 | possibly damaging |
1.834 |
TOLERATED | 0.25 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217108652 | NA | 6.01E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 4.08E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 3.64E-07 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 3.30E-07 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | 4.04E-06 | NA | mr1034 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 9.70E-07 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 1.19E-07 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 4.90E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 1.25E-06 | mr1154 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 5.07E-06 | mr1013_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 5.94E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217108652 | NA | 8.89E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |