Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217104604:

Variant ID: vg1217104604 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17104604
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGTTTTTATCACACATGTCTCCCTTATTACATGAATACAAGGCACTGCCTTAAACAAAAAGGGAAGGTGCTTAACATCGGTACATTGTATCCTCGACA[G/T]
GAATCATCCATAAACGTAGCAAGCTCATTATTTATAATCATGAATATATTTATTTATTACATGATTGCTGCAAACTCCCGATTACAGTGATAAGTAGCGA

Reverse complement sequence

TCGCTACTTATCACTGTAATCGGGAGTTTGCAGCAATCATGTAATAAATAAATATATTCATGATTATAAATAATGAGCTTGCTACGTTTATGGATGATTC[C/A]
TGTCGAGGATACAATGTACCGATGTTAAGCACCTTCCCTTTTTGTTTAAGGCAGTGCCTTGTATTCATGTAATAAGGGAGACATGTGTGATAAAAACAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 1.30% 45.22% 16.34% NA
All Indica  2759 31.10% 2.00% 62.67% 4.20% NA
All Japonica  1512 49.70% 0.10% 12.17% 38.10% NA
Aus  269 17.10% 1.10% 59.48% 22.30% NA
Indica I  595 22.20% 1.20% 68.07% 8.57% NA
Indica II  465 10.30% 3.40% 81.08% 5.16% NA
Indica III  913 50.10% 2.10% 47.10% 0.77% NA
Indica Intermediate  786 28.10% 1.80% 65.78% 4.33% NA
Temperate Japonica  767 79.30% 0.00% 0.91% 19.82% NA
Tropical Japonica  504 13.10% 0.20% 28.57% 58.13% NA
Japonica Intermediate  241 32.00% 0.00% 13.69% 54.36% NA
VI/Aromatic  96 60.40% 0.00% 34.38% 5.21% NA
Intermediate  90 48.90% 0.00% 34.44% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217104604 G -> DEL N N silent_mutation Average:16.43; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg1217104604 G -> T LOC_Os12g28930.1 downstream_gene_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:16.43; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg1217104604 G -> T LOC_Os12g28920-LOC_Os12g28930 intergenic_region ; MODIFIER silent_mutation Average:16.43; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217104604 8.66E-06 7.38E-37 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 1.84E-07 NA mr1023 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 3.74E-35 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 3.08E-06 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 1.11E-07 NA mr1142 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 3.82E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 2.41E-19 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 6.73E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 6.34E-10 9.70E-95 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 9.12E-07 4.45E-09 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 1.10E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 8.83E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 1.56E-06 NA mr1390 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 5.70E-15 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 6.19E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 3.35E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 3.60E-06 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 8.63E-06 NA mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 6.56E-06 NA mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 5.58E-22 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 4.93E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 7.31E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 3.30E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 2.70E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 1.55E-06 1.55E-46 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 3.45E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 3.25E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 1.32E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 1.80E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 2.18E-09 1.89E-101 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 6.18E-17 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 2.60E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 4.82E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 8.76E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 4.57E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 1.55E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217104604 NA 1.05E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251