\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217103792:

Variant ID: vg1217103792 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17103792
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCTAGATACTACTGCTATTCGATGCAAGGGTCGATAACTTTTGCCTTTGAATTACGTTTCTCAAAAGAACCAACTTATCCCACTTGACATGCTTTGAC[A/G]
TCTTTCTAAATGACTTTACTGCTGAACTTGTTATTGTCTGATCGTTTTCCTGCCAAATCTGAAGCTTCGTTGTTAGATGTGATTTTAATCTGACCTCTGT

Reverse complement sequence

ACAGAGGTCAGATTAAAATCACATCTAACAACGAAGCTTCAGATTTGGCAGGAAAACGATCAGACAATAACAAGTTCAGCAGTAAAGTCATTTAGAAAGA[T/C]
GTCAAAGCATGTCAAGTGGGATAAGTTGGTTCTTTTGAGAAACGTAATTCAAAGGCAAAAGTTATCGACCCTTGCATCGAATAGCAGTAGTATCTAGCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 2.20% 46.17% 17.77% NA
All Indica  2759 12.90% 1.00% 61.91% 24.18% NA
All Japonica  1512 67.10% 4.00% 22.16% 6.81% NA
Aus  269 57.20% 2.60% 24.91% 15.24% NA
Indica I  595 5.70% 0.50% 59.83% 33.95% NA
Indica II  465 18.90% 1.50% 52.69% 26.88% NA
Indica III  913 9.50% 1.10% 70.97% 18.40% NA
Indica Intermediate  786 18.80% 0.90% 58.40% 21.88% NA
Temperate Japonica  767 94.80% 0.00% 4.04% 1.17% NA
Tropical Japonica  504 20.00% 11.50% 52.38% 16.07% NA
Japonica Intermediate  241 77.20% 0.80% 16.60% 5.39% NA
VI/Aromatic  96 32.30% 7.30% 47.92% 12.50% NA
Intermediate  90 48.90% 3.30% 28.89% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217103792 A -> DEL N N silent_mutation Average:15.798; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg1217103792 A -> G LOC_Os12g28920.1 downstream_gene_variant ; 4820.0bp to feature; MODIFIER silent_mutation Average:15.798; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg1217103792 A -> G LOC_Os12g28930.1 downstream_gene_variant ; 933.0bp to feature; MODIFIER silent_mutation Average:15.798; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg1217103792 A -> G LOC_Os12g28920-LOC_Os12g28930 intergenic_region ; MODIFIER silent_mutation Average:15.798; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217103792 NA 3.31E-18 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 6.24E-08 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 8.02E-16 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 6.79E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.71E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 7.59E-09 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.93E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.26E-07 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 4.98E-11 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.03E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 2.09E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 8.02E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 2.05E-07 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.96E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.28E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 5.65E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.14E-20 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 3.54E-33 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.31E-12 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 3.19E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.28E-16 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 4.76E-15 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 1.09E-16 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 7.36E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 2.88E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 2.07E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 8.88E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 3.03E-06 9.66E-11 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 7.80E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 6.35E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 4.97E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217103792 NA 7.27E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251