\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217065594:

Variant ID: vg1217065594 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17065594
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAATTACTTCCTCCGTTTCATATTATAAGACTTTTTAGTACTGCCCATCTAGATTCATTAACATCTATATGAATATGGACAATGTCTAGATTCATTAA[T/C]
ATCTATATGAATATGGATAATGCTAGAAAGTCTTATAATAAAAAACGGATGGAGTACATGACAACTTTATTGTTGGTATAAACGTTTTACGTGATACAAA

Reverse complement sequence

TTTGTATCACGTAAAACGTTTATACCAACAATAAAGTTGTCATGTACTCCATCCGTTTTTTATTATAAGACTTTCTAGCATTATCCATATTCATATAGAT[A/G]
TTAATGAATCTAGACATTGTCCATATTCATATAGATGTTAATGAATCTAGATGGGCAGTACTAAAAAGTCTTATAATATGAAACGGAGGAAGTAATTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 27.60% 4.19% 2.69% NA
All Indica  2759 66.30% 32.10% 0.98% 0.69% NA
All Japonica  1512 73.60% 26.00% 0.40% 0.00% NA
Aus  269 19.00% 1.90% 43.12% 36.06% NA
Indica I  595 91.90% 8.10% 0.00% 0.00% NA
Indica II  465 31.60% 67.30% 0.86% 0.22% NA
Indica III  913 72.80% 25.30% 1.42% 0.44% NA
Indica Intermediate  786 59.70% 37.30% 1.27% 1.78% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 42.30% 57.30% 0.40% 0.00% NA
Japonica Intermediate  241 68.90% 29.50% 1.66% 0.00% NA
VI/Aromatic  96 41.70% 1.00% 46.88% 10.42% NA
Intermediate  90 73.30% 21.10% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217065594 T -> C LOC_Os12g28860.1 upstream_gene_variant ; 2026.0bp to feature; MODIFIER silent_mutation Average:32.316; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1217065594 T -> C LOC_Os12g28870.1 downstream_gene_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:32.316; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1217065594 T -> C LOC_Os12g28870-LOC_Os12g28880 intergenic_region ; MODIFIER silent_mutation Average:32.316; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1217065594 T -> DEL N N silent_mutation Average:32.316; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217065594 NA 4.03E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.87E-07 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 7.20E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.03E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 7.64E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.99E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 4.89E-09 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.77E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 8.56E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 5.35E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 6.39E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 3.67E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.44E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 8.66E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 3.92E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 2.36E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.82E-08 mr1835 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.23E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 5.86E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 7.00E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.83E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217065594 NA 1.47E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251