Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217064594:

Variant ID: vg1217064594 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17064594
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCTGATCAGCGATCGATCAGTCCTTGTCCGATTGCTACTCCAACTCGATATTTCGACGCCGATATATACGTCGATCGACACCAAAAGCTGCTCATCGA[C/T]
CGATCGACGCCATGGCTGCCATGCAAGTGCAAGGTCATCCCCTCCATCTGGCGGTGGCGGCGGTCTACGTCCGCCTCGTCGTGGACAACCTGACGACGAC

Reverse complement sequence

GTCGTCGTCAGGTTGTCCACGACGAGGCGGACGTAGACCGCCGCCACCGCCAGATGGAGGGGATGACCTTGCACTTGCATGGCAGCCATGGCGTCGATCG[G/A]
TCGATGAGCAGCTTTTGGTGTCGATCGACGTATATATCGGCGTCGAAATATCGAGTTGGAGTAGCAATCGGACAAGGACTGATCGATCGCTGATCAGCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.80%	0.06%	0.00%	NA
All Indica	2759	92.40%	7.60%	0.04%	0.00%	NA
All Japonica	1512	93.30%	6.70%	0.07%	0.00%	NA
Aus	269	97.80%	1.90%	0.37%	0.00%	NA
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	82.80%	17.20%	0.00%	0.00%	NA
Indica III	913	94.50%	5.40%	0.11%	0.00%	NA
Indica Intermediate	786	92.60%	7.40%	0.00%	0.00%	NA
Temperate Japonica	767	97.50%	2.30%	0.13%	0.00%	NA
Tropical Japonica	504	89.10%	10.90%	0.00%	0.00%	NA
Japonica Intermediate	241	88.40%	11.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217064594	C -> T	LOC_Os12g28860.1	upstream_gene_variant ; 1026.0bp to feature; MODIFIER	silent_mutation	Average:66.054; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1217064594	C -> T	LOC_Os12g28870.1	upstream_gene_variant ; 12.0bp to feature; MODIFIER	silent_mutation	Average:66.054; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N
vg1217064594	C -> T	LOC_Os12g28860-LOC_Os12g28870	intergenic_region ; MODIFIER	silent_mutation	Average:66.054; most accessible tissue: Zhenshan97 young leaf, score: 88.878	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217064594	NA	2.32E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	5.33E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	4.92E-06	2.94E-12	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	4.51E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	9.06E-12	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	9.00E-12	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	4.50E-12	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	2.35E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	2.91E-06	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	4.09E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	2.60E-06	1.14E-07	mr1835	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	4.17E-06	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	1.34E-10	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	4.46E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	8.74E-07	5.07E-14	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	3.82E-07	1.51E-15	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	1.93E-06	1.56E-14	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	NA	1.36E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	6.27E-09	3.20E-17	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594	7.77E-09	1.96E-17	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251