\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217064594:

Variant ID: vg1217064594 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17064594
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCTGATCAGCGATCGATCAGTCCTTGTCCGATTGCTACTCCAACTCGATATTTCGACGCCGATATATACGTCGATCGACACCAAAAGCTGCTCATCGA[C/T]
CGATCGACGCCATGGCTGCCATGCAAGTGCAAGGTCATCCCCTCCATCTGGCGGTGGCGGCGGTCTACGTCCGCCTCGTCGTGGACAACCTGACGACGAC

Reverse complement sequence

GTCGTCGTCAGGTTGTCCACGACGAGGCGGACGTAGACCGCCGCCACCGCCAGATGGAGGGGATGACCTTGCACTTGCATGGCAGCCATGGCGTCGATCG[G/A]
TCGATGAGCAGCTTTTGGTGTCGATCGACGTATATATCGGCGTCGAAATATCGAGTTGGAGTAGCAATCGGACAAGGACTGATCGATCGCTGATCAGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.80% 0.06% 0.00% NA
All Indica  2759 92.40% 7.60% 0.04% 0.00% NA
All Japonica  1512 93.30% 6.70% 0.07% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 82.80% 17.20% 0.00% 0.00% NA
Indica III  913 94.50% 5.40% 0.11% 0.00% NA
Indica Intermediate  786 92.60% 7.40% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.30% 0.13% 0.00% NA
Tropical Japonica  504 89.10% 10.90% 0.00% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217064594 C -> T LOC_Os12g28860.1 upstream_gene_variant ; 1026.0bp to feature; MODIFIER silent_mutation Average:66.054; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg1217064594 C -> T LOC_Os12g28870.1 upstream_gene_variant ; 12.0bp to feature; MODIFIER silent_mutation Average:66.054; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg1217064594 C -> T LOC_Os12g28860-LOC_Os12g28870 intergenic_region ; MODIFIER silent_mutation Average:66.054; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217064594 NA 2.32E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 5.33E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 4.92E-06 2.94E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 4.51E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 9.06E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 9.00E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 4.50E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 2.35E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 2.91E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 4.09E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 2.60E-06 1.14E-07 mr1835 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 4.17E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 1.34E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 4.46E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 8.74E-07 5.07E-14 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 3.82E-07 1.51E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 1.93E-06 1.56E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 NA 1.36E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 6.27E-09 3.20E-17 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064594 7.77E-09 1.96E-17 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251