\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217064292:

Variant ID: vg1217064292 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17064292
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTAATCTTTTTCGACTTTTTATTAATTTTCTCGTGTTTTCTTCCCGTTGAAACGCACGGATATTTTTTCTAGTATTTTAATAATATACTAGTTTTAAGT[T/G]
AAAAATGTTGGCTATACTTTTTAGTAAACTTATTTAATTTATTTTTAAAAATAATTAGAAAAAAATCAAAACGGCTTATAATAATACAAAACAACGGCAG

Reverse complement sequence

CTGCCGTTGTTTTGTATTATTATAAGCCGTTTTGATTTTTTTCTAATTATTTTTAAAAATAAATTAAATAAGTTTACTAAAAAGTATAGCCAACATTTTT[A/C]
ACTTAAAACTAGTATATTATTAAAATACTAGAAAAAATATCCGTGCGTTTCAACGGGAAGAAAACACGAGAAAATTAATAAAAAGTCGAAAAAGATTAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 5.20% 0.13% 13.29% NA
All Indica  2759 82.30% 5.10% 0.11% 12.47% NA
All Japonica  1512 93.10% 6.60% 0.00% 0.33% NA
Aus  269 17.80% 0.40% 0.74% 81.04% NA
Indica I  595 94.60% 3.70% 0.17% 1.51% NA
Indica II  465 71.80% 15.90% 0.22% 12.04% NA
Indica III  913 81.90% 2.30% 0.11% 15.66% NA
Indica Intermediate  786 79.80% 2.90% 0.00% 17.30% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 88.90% 10.70% 0.00% 0.40% NA
Japonica Intermediate  241 87.10% 11.60% 0.00% 1.24% NA
VI/Aromatic  96 43.80% 0.00% 0.00% 56.25% NA
Intermediate  90 87.80% 3.30% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217064292 T -> DEL N N silent_mutation Average:36.645; most accessible tissue: Callus, score: 69.732 N N N N
vg1217064292 T -> G LOC_Os12g28860.1 upstream_gene_variant ; 724.0bp to feature; MODIFIER silent_mutation Average:36.645; most accessible tissue: Callus, score: 69.732 N N N N
vg1217064292 T -> G LOC_Os12g28870.1 upstream_gene_variant ; 314.0bp to feature; MODIFIER silent_mutation Average:36.645; most accessible tissue: Callus, score: 69.732 N N N N
vg1217064292 T -> G LOC_Os12g28860-LOC_Os12g28870 intergenic_region ; MODIFIER silent_mutation Average:36.645; most accessible tissue: Callus, score: 69.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217064292 NA 7.00E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 2.23E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 2.93E-06 NA mr1021 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 5.90E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 3.70E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 1.39E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 2.23E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 9.42E-06 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 2.16E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 3.13E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 5.31E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 1.55E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 1.96E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 1.54E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 4.80E-07 NA mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 7.63E-07 7.62E-16 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 7.27E-15 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 NA 2.97E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 7.80E-08 3.70E-18 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217064292 9.95E-09 1.85E-18 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251