Variant ID: vg1217063939 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 17063939 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTATCATACATGGGTCCCATATTTTTTTAATAAATAAAATGCTGACTGGATTGCTACGCGTACGCCACGTAGGACAAAACCGCTCTGAATTGGGTCGAGG[G/A]
GGTAATTTGTCCGGTATTGAAAGTTGAGGGTGAACGATGTCTGGTTTTCGGGTTTAGAGGGGTAATTCGGTCGACCGCGATAGTTCAGGAGGTAATTCGA
TCGAATTACCTCCTGAACTATCGCGGTCGACCGAATTACCCCTCTAAACCCGAAAACCAGACATCGTTCACCCTCAACTTTCAATACCGGACAAATTACC[C/T]
CCTCGACCCAATTCAGAGCGGTTTTGTCCTACGTGGCGTACGCGTAGCAATCCAGTCAGCATTTTATTTATTAAAAAAATATGGGACCCATGTATGATAC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 74.70% | 7.30% | 0.44% | 17.60% | NA |
All Indica | 2759 | 82.00% | 1.10% | 0.36% | 16.56% | NA |
All Japonica | 1512 | 74.00% | 18.80% | 0.26% | 6.88% | NA |
Aus | 269 | 12.30% | 7.80% | 1.86% | 78.07% | NA |
Indica I | 595 | 94.50% | 0.30% | 0.17% | 5.04% | NA |
Indica II | 465 | 71.20% | 1.30% | 0.22% | 27.31% | NA |
Indica III | 913 | 82.70% | 0.30% | 0.44% | 16.54% | NA |
Indica Intermediate | 786 | 78.20% | 2.30% | 0.51% | 18.96% | NA |
Temperate Japonica | 767 | 79.30% | 18.10% | 0.26% | 2.35% | NA |
Tropical Japonica | 504 | 76.60% | 12.30% | 0.20% | 10.91% | NA |
Japonica Intermediate | 241 | 51.90% | 34.90% | 0.41% | 12.86% | NA |
VI/Aromatic | 96 | 44.80% | 1.00% | 2.08% | 52.08% | NA |
Intermediate | 90 | 78.90% | 8.90% | 0.00% | 12.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1217063939 | G -> DEL | N | N | silent_mutation | Average:58.016; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
vg1217063939 | G -> A | LOC_Os12g28860.1 | upstream_gene_variant ; 371.0bp to feature; MODIFIER | silent_mutation | Average:58.016; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
vg1217063939 | G -> A | LOC_Os12g28870.1 | upstream_gene_variant ; 667.0bp to feature; MODIFIER | silent_mutation | Average:58.016; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
vg1217063939 | G -> A | LOC_Os12g28860-LOC_Os12g28870 | intergenic_region ; MODIFIER | silent_mutation | Average:58.016; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1217063939 | NA | 7.27E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | 7.58E-07 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | 3.89E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | 2.40E-06 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | NA | 1.00E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | 1.44E-07 | NA | mr1178_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | NA | 5.10E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | NA | 1.18E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | NA | 2.24E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217063939 | NA | 1.74E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |