\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217063939:

Variant ID: vg1217063939 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17063939
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATCATACATGGGTCCCATATTTTTTTAATAAATAAAATGCTGACTGGATTGCTACGCGTACGCCACGTAGGACAAAACCGCTCTGAATTGGGTCGAGG[G/A]
GGTAATTTGTCCGGTATTGAAAGTTGAGGGTGAACGATGTCTGGTTTTCGGGTTTAGAGGGGTAATTCGGTCGACCGCGATAGTTCAGGAGGTAATTCGA

Reverse complement sequence

TCGAATTACCTCCTGAACTATCGCGGTCGACCGAATTACCCCTCTAAACCCGAAAACCAGACATCGTTCACCCTCAACTTTCAATACCGGACAAATTACC[C/T]
CCTCGACCCAATTCAGAGCGGTTTTGTCCTACGTGGCGTACGCGTAGCAATCCAGTCAGCATTTTATTTATTAAAAAAATATGGGACCCATGTATGATAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 7.30% 0.44% 17.60% NA
All Indica  2759 82.00% 1.10% 0.36% 16.56% NA
All Japonica  1512 74.00% 18.80% 0.26% 6.88% NA
Aus  269 12.30% 7.80% 1.86% 78.07% NA
Indica I  595 94.50% 0.30% 0.17% 5.04% NA
Indica II  465 71.20% 1.30% 0.22% 27.31% NA
Indica III  913 82.70% 0.30% 0.44% 16.54% NA
Indica Intermediate  786 78.20% 2.30% 0.51% 18.96% NA
Temperate Japonica  767 79.30% 18.10% 0.26% 2.35% NA
Tropical Japonica  504 76.60% 12.30% 0.20% 10.91% NA
Japonica Intermediate  241 51.90% 34.90% 0.41% 12.86% NA
VI/Aromatic  96 44.80% 1.00% 2.08% 52.08% NA
Intermediate  90 78.90% 8.90% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217063939 G -> DEL N N silent_mutation Average:58.016; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1217063939 G -> A LOC_Os12g28860.1 upstream_gene_variant ; 371.0bp to feature; MODIFIER silent_mutation Average:58.016; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1217063939 G -> A LOC_Os12g28870.1 upstream_gene_variant ; 667.0bp to feature; MODIFIER silent_mutation Average:58.016; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1217063939 G -> A LOC_Os12g28860-LOC_Os12g28870 intergenic_region ; MODIFIER silent_mutation Average:58.016; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217063939 NA 7.27E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 7.58E-07 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 3.89E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 2.40E-06 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 NA 1.00E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 1.44E-07 NA mr1178_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 NA 5.10E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 NA 1.18E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 NA 2.24E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217063939 NA 1.74E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251