\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217054050:

Variant ID: vg1217054050 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17054050
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCGTTTTGCTCACGCTGGCTCTGATCGAGGACCTCGATTCGCCGGCGAATCGTGGTCTCGAACTCCTGCGTGGAGCGGACACGCTCATCCAAGGCCCT[G/A,C]
CGTTCGGCCTCGAGCGCCGCTGTCCGAGCCCGCAGCGAGGCATCGGCCTCCGATACCCGCTGCTCTTGGGCAGCAGCTGCGTCGAGGATACCGCGGGCGT

Reverse complement sequence

ACGCCCGCGGTATCCTCGACGCAGCTGCTGCCCAAGAGCAGCGGGTATCGGAGGCCGATGCCTCGCTGCGGGCTCGGACAGCGGCGCTCGAGGCCGAACG[C/T,G]
AGGGCCTTGGATGAGCGTGTCCGCTCCACGCAGGAGTTCGAGACCACGATTCGCCGGCGAATCGAGGTCCTCGATCAGAGCCAGCGTGAGCAAAACGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 8.20% 2.22% 7.11% C: 0.08%
All Indica  2759 76.00% 13.50% 3.30% 7.00% C: 0.14%
All Japonica  1512 92.90% 0.50% 0.13% 6.48% NA
Aus  269 95.50% 0.70% 1.49% 2.23% NA
Indica I  595 92.90% 2.70% 0.50% 3.87% NA
Indica II  465 43.40% 35.10% 6.02% 15.48% NA
Indica III  913 84.70% 7.30% 2.96% 5.04% NA
Indica Intermediate  786 72.50% 16.20% 4.20% 6.62% C: 0.51%
Temperate Japonica  767 97.40% 0.40% 0.00% 2.22% NA
Tropical Japonica  504 89.30% 0.60% 0.40% 9.72% NA
Japonica Intermediate  241 86.30% 0.40% 0.00% 13.28% NA
VI/Aromatic  96 57.30% 1.00% 5.21% 36.46% NA
Intermediate  90 88.90% 3.30% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217054050 G -> C LOC_Os12g28850.1 missense_variant ; p.Ala710Gly; MODERATE nonsynonymous_codon ; A710G Average:70.58; most accessible tissue: Zhenshan97 flag leaf, score: 89.423 unknown unknown TOLERATED 0.08
vg1217054050 G -> DEL LOC_Os12g28850.1 N frameshift_variant Average:70.58; most accessible tissue: Zhenshan97 flag leaf, score: 89.423 N N N N
vg1217054050 G -> A LOC_Os12g28850.1 missense_variant ; p.Ala710Val; MODERATE nonsynonymous_codon ; A710V Average:70.58; most accessible tissue: Zhenshan97 flag leaf, score: 89.423 unknown unknown DELETERIOUS 0.02

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217054050 G A 0.0 0.0 -0.01 -0.01 -0.01 -0.01
vg1217054050 G C -0.01 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217054050 NA 1.12E-07 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 8.91E-09 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 3.57E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 1.10E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 1.29E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 5.17E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 8.15E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 1.63E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 4.08E-06 mr1439_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 8.79E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 7.02E-06 NA mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 1.33E-06 1.77E-07 mr1712_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 9.28E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054050 NA 5.16E-06 mr1910_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251