\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217053914:

Variant ID: vg1217053914 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17053914
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGCCTCCACCTCCGCTGCTGTTCTCTCGTGGGCGGCCAAGGTGGACTCCCGCAGATCGAGCAGACGCGCTCGCTCCTCCAGCGCCTGAGTCCGCCTCT[A/C]
CAGCTCCTGGGCTCGCTGCGCCTGCTCCTGGCCACGCGCGTTTTGCTCACGCTGGCTCTGATCGAGGACCTCGATTCGCCGGCGAATCGTGGTCTCGAAC

Reverse complement sequence

GTTCGAGACCACGATTCGCCGGCGAATCGAGGTCCTCGATCAGAGCCAGCGTGAGCAAAACGCGCGTGGCCAGGAGCAGGCGCAGCGAGCCCAGGAGCTG[T/G]
AGAGGCGGACTCAGGCGCTGGAGGAGCGAGCGCGTCTGCTCGATCTGCGGGAGTCCACCTTGGCCGCCCACGAGAGAACAGCAGCGGAGGTGGAGGCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 22.40% 0.06% 18.32% NA
All Indica  2759 80.50% 2.20% 0.07% 17.25% NA
All Japonica  1512 30.20% 62.70% 0.00% 7.08% NA
Aus  269 9.70% 8.60% 0.00% 81.78% NA
Indica I  595 93.80% 1.20% 0.00% 5.04% NA
Indica II  465 68.40% 3.00% 0.00% 28.60% NA
Indica III  913 82.30% 0.20% 0.22% 17.31% NA
Indica Intermediate  786 75.40% 4.80% 0.00% 19.72% NA
Temperate Japonica  767 2.70% 94.90% 0.00% 2.35% NA
Tropical Japonica  504 74.80% 13.90% 0.00% 11.31% NA
Japonica Intermediate  241 24.50% 62.20% 0.00% 13.28% NA
VI/Aromatic  96 44.80% 0.00% 0.00% 55.21% NA
Intermediate  90 56.70% 31.10% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217053914 A -> C LOC_Os12g28840.1 upstream_gene_variant ; 3562.0bp to feature; MODIFIER silent_mutation Average:67.715; most accessible tissue: Zhenshan97 flag leaf, score: 88.445 N N N N
vg1217053914 A -> C LOC_Os12g28850.1 intron_variant ; MODIFIER silent_mutation Average:67.715; most accessible tissue: Zhenshan97 flag leaf, score: 88.445 N N N N
vg1217053914 A -> DEL N N silent_mutation Average:67.715; most accessible tissue: Zhenshan97 flag leaf, score: 88.445 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217053914 A C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217053914 NA 3.58E-34 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 3.74E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 8.30E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 9.02E-07 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 3.38E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 5.62E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 6.47E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 9.79E-06 4.43E-08 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 7.11E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 8.83E-06 NA mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 1.41E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 7.07E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 2.70E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 4.60E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 6.01E-07 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 4.08E-07 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 6.01E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 5.47E-18 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 3.46E-07 1.69E-21 mr1540_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 2.21E-16 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 6.76E-06 NA mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 1.32E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 4.49E-08 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 7.47E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 7.05E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 1.15E-07 4.53E-21 mr1732_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 6.22E-06 3.21E-16 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 NA 3.22E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 1.92E-08 1.11E-16 mr1879_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 2.39E-07 8.85E-13 mr1879_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217053914 3.15E-07 2.49E-06 mr1899_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251