\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217052179:

Variant ID: vg1217052179 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17052179
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCGACGGCCTATGCGGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAATCTGAGGTGTGGTGTGCTT[G/A]
GTTAGAGGGAGTTATGAGAAGGGTCCTATCACGACCTCTTTCCAGTATGTCGTGGTGGCATGTCAGCGCACGGAAACGTGTCGTGGGGCTATGTCTTGTG

Reverse complement sequence

CACAAGACATAGCCCCACGACACGTTTCCGTGCGCTGACATGCCACCACGACATACTGGAAAGAGGTCGTGATAGGACCCTTCTCATAACTCCCTCTAAC[C/T]
AAGCACACCACACCTCAGATTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCCGCATAGGCCGTCGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 20.90% 4.21% 14.01% NA
All Indica  2759 48.30% 34.40% 1.34% 15.91% NA
All Japonica  1512 92.60% 0.40% 0.46% 6.55% NA
Aus  269 14.10% 5.60% 47.58% 32.71% NA
Indica I  595 17.30% 77.50% 0.17% 5.04% NA
Indica II  465 57.80% 14.00% 0.65% 27.53% NA
Indica III  913 62.10% 20.70% 1.86% 15.33% NA
Indica Intermediate  786 50.10% 29.90% 2.04% 17.94% NA
Temperate Japonica  767 97.30% 0.40% 0.00% 2.35% NA
Tropical Japonica  504 88.70% 0.20% 0.79% 10.32% NA
Japonica Intermediate  241 85.90% 0.80% 1.24% 12.03% NA
VI/Aromatic  96 36.50% 9.40% 26.04% 28.12% NA
Intermediate  90 77.80% 10.00% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217052179 G -> DEL N N silent_mutation Average:42.025; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1217052179 G -> A LOC_Os12g28840.1 upstream_gene_variant ; 1827.0bp to feature; MODIFIER silent_mutation Average:42.025; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1217052179 G -> A LOC_Os12g28830.1 downstream_gene_variant ; 3727.0bp to feature; MODIFIER silent_mutation Average:42.025; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1217052179 G -> A LOC_Os12g28850.1 downstream_gene_variant ; 648.0bp to feature; MODIFIER silent_mutation Average:42.025; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1217052179 G -> A LOC_Os12g28840-LOC_Os12g28850 intergenic_region ; MODIFIER silent_mutation Average:42.025; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217052179 NA 6.37E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 7.27E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 3.86E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 7.42E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 3.37E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 4.19E-06 NA mr1314 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 6.41E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 9.22E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 7.92E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 6.44E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 3.24E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 4.14E-09 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 2.16E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 6.37E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 1.26E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217052179 NA 5.96E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251