\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217048370:

Variant ID: vg1217048370 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17048370
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCAACCAGGATGATCTTCGCCGCGACGATCTCGTTTATCTTGAAGAATGGAGAAGGCGTGTGGCCCTGCGTGCCGCGTGCTACCAACAAAGCCTGTGGC[G/A]
CTACCATCAGCGCCTCGTCCGGGCCCAGTCACTGCAAGTTGGCGATCTCGTCCTACGCCGCGTCCAATCGCGTCTGGGCTGAGCAAGCTCTCGCCAATGT

Reverse complement sequence

ACATTGGCGAGAGCTTGCTCAGCCCAGACGCGATTGGACGCGGCGTAGGACGAGATCGCCAACTTGCAGTGACTGGGCCCGGACGAGGCGCTGATGGTAG[C/T]
GCCACAGGCTTTGTTGGTAGCACGCGGCACGCAGGGCCACACGCCTTCTCCATTCTTCAAGATAAACGAGATCGTCGCGGCGAAGATCATCCTGGTTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 6.40% 0.72% 15.51% NA
All Indica  2759 84.30% 0.70% 0.76% 14.28% NA
All Japonica  1512 77.10% 16.60% 0.26% 6.08% NA
Aus  269 16.00% 9.70% 2.23% 72.12% NA
Indica I  595 95.30% 0.30% 0.00% 4.37% NA
Indica II  465 78.50% 0.40% 0.86% 20.22% NA
Indica III  913 82.70% 0.90% 0.99% 15.44% NA
Indica Intermediate  786 81.30% 0.80% 1.02% 16.92% NA
Temperate Japonica  767 85.00% 12.90% 0.13% 1.96% NA
Tropical Japonica  504 77.60% 12.50% 0.40% 9.52% NA
Japonica Intermediate  241 50.60% 36.90% 0.41% 12.03% NA
VI/Aromatic  96 49.00% 2.10% 3.12% 45.83% NA
Intermediate  90 82.20% 7.80% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217048370 G -> DEL LOC_Os12g28830.1 N frameshift_variant Average:63.854; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 N N N N
vg1217048370 G -> A LOC_Os12g28830.1 missense_variant ; p.Arg804His; MODERATE nonsynonymous_codon ; R804H Average:63.854; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 probably damaging 2.33 DELETERIOUS 0.02

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217048370 G A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217048370 NA 4.03E-08 mr1280 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 1.47E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 8.45E-06 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 2.60E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 6.31E-07 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 4.92E-08 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 1.42E-06 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 3.78E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 2.96E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 2.86E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 6.16E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 6.97E-06 mr1788_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217048370 NA 1.18E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251