\
| Variant ID: vg1217039777 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17039777 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.27, others allele: 0.00, population size: 97. )
AAAAAAACATACCTATACATATGGTAATACGTACAGGCTCAAGGTGGACCCGGTTTGGGGGTTAGGCAATCTTTTTTAATAAATTTAATGGTGGTAAATA[T/A]
TGGGTCCACCTAATTTAATGAAGATCAATGGCTAGAGAATTTTTATAAATTTCTATAAATTACAGTGCCACATGGCGACTTAGGAGTGTTTATAGGATGT
ACATCCTATAAACACTCCTAAGTCGCCATGTGGCACTGTAATTTATAGAAATTTATAAAAATTCTCTAGCCATTGATCTTCATTAAATTAGGTGGACCCA[A/T]
TATTTACCACCATTAAATTTATTAAAAAAGATTGCCTAACCCCCAAACCGGGTCCACCTTGAGCCTGTACGTATTACCATATGTATAGGTATGTTTTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.80% | 36.90% | 0.25% | 18.03% | NA |
| All Indica | 2759 | 22.30% | 60.50% | 0.18% | 16.96% | NA |
| All Japonica | 1512 | 92.20% | 0.80% | 0.20% | 6.81% | NA |
| Aus | 269 | 10.00% | 8.20% | 1.12% | 80.67% | NA |
| Indica I | 595 | 5.00% | 90.10% | 0.00% | 4.87% | NA |
| Indica II | 465 | 55.10% | 17.60% | 0.22% | 27.10% | NA |
| Indica III | 913 | 11.70% | 70.60% | 0.11% | 17.52% | NA |
| Indica Intermediate | 786 | 28.40% | 51.80% | 0.38% | 19.47% | NA |
| Temperate Japonica | 767 | 97.00% | 0.70% | 0.13% | 2.22% | NA |
| Tropical Japonica | 504 | 87.90% | 0.80% | 0.40% | 10.91% | NA |
| Japonica Intermediate | 241 | 85.90% | 1.20% | 0.00% | 12.86% | NA |
| VI/Aromatic | 96 | 28.10% | 16.70% | 0.00% | 55.21% | NA |
| Intermediate | 90 | 61.10% | 25.60% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217039777 | T -> DEL | N | N | silent_mutation | Average:41.678; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1217039777 | T -> A | LOC_Os12g28810.1 | upstream_gene_variant ; 4095.0bp to feature; MODIFIER | silent_mutation | Average:41.678; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1217039777 | T -> A | LOC_Os12g28830.1 | upstream_gene_variant ; 2770.0bp to feature; MODIFIER | silent_mutation | Average:41.678; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1217039777 | T -> A | LOC_Os12g28820.1 | downstream_gene_variant ; 874.0bp to feature; MODIFIER | silent_mutation | Average:41.678; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1217039777 | T -> A | LOC_Os12g28820-LOC_Os12g28830 | intergenic_region ; MODIFIER | silent_mutation | Average:41.678; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217039777 | NA | 7.75E-08 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.05E-13 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.96E-07 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 5.24E-07 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.18E-08 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 2.39E-08 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.88E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 5.74E-11 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.38E-07 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 6.09E-19 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 8.76E-10 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 2.90E-20 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 5.03E-12 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 7.02E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 6.53E-21 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 2.63E-12 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 2.14E-08 | mr1185 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.51E-07 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 6.68E-08 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 4.16E-08 | mr1269 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 2.27E-13 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 9.06E-08 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 8.58E-07 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 4.99E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 7.81E-12 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 4.26E-08 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 8.07E-09 | mr1479 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 4.11E-08 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.29E-08 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 4.58E-08 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.37E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 5.52E-21 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 7.14E-13 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 5.44E-07 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 7.42E-20 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 7.01E-12 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.17E-08 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.20E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.22E-06 | mr1678 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.04E-07 | mr1698 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.76E-15 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 6.96E-09 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 9.76E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.38E-08 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 8.33E-06 | mr1835 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.53E-09 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.80E-06 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.05E-07 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 4.94E-16 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.64E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 8.30E-20 | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.66E-11 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 7.49E-09 | mr1975 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.49E-07 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 3.69E-10 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 2.23E-20 | mr1995 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 1.27E-12 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 5.01E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217039777 | NA | 4.28E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |