\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217008330:

Variant ID: vg1217008330 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17008330
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGTTTGATGCAACAATAGCATGGGAAATTATCATAAAACTGTAAGTTTTACGTGATATGCTGCTACATGACAAAAGTTGTAGTTTTGTGATAATTTCC[C/T]
ACGCAATTGTTGTAGCAAACTGAAATAGATCACTAATATTGTAGTAAACTGATAGTTTTGTTACTATAGTTGCAGTTTTTTGAAATTTACTCTATAATTA

Reverse complement sequence

TAATTATAGAGTAAATTTCAAAAAACTGCAACTATAGTAACAAAACTATCAGTTTACTACAATATTAGTGATCTATTTCAGTTTGCTACAACAATTGCGT[G/A]
GGAAATTATCACAAAACTACAACTTTTGTCATGTAGCAGCATATCACGTAAAACTTACAGTTTTATGATAATTTCCCATGCTATTGTTGCATCAAACTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 26.50% 0.44% 14.30% NA
All Indica  2759 48.10% 36.80% 0.43% 14.72% NA
All Japonica  1512 88.80% 10.80% 0.07% 0.40% NA
Aus  269 13.40% 7.80% 2.23% 76.58% NA
Indica I  595 20.80% 77.30% 0.34% 1.51% NA
Indica II  465 50.80% 23.90% 1.08% 24.30% NA
Indica III  913 62.50% 21.80% 0.11% 15.55% NA
Indica Intermediate  786 50.30% 31.20% 0.51% 18.07% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 71.60% 28.00% 0.00% 0.40% NA
Japonica Intermediate  241 90.90% 7.10% 0.41% 1.66% NA
VI/Aromatic  96 8.30% 36.50% 2.08% 53.12% NA
Intermediate  90 70.00% 22.20% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217008330 C -> DEL N N silent_mutation Average:27.924; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1217008330 C -> T LOC_Os12g28770.1 downstream_gene_variant ; 1052.0bp to feature; MODIFIER silent_mutation Average:27.924; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1217008330 C -> T LOC_Os12g28760-LOC_Os12g28770 intergenic_region ; MODIFIER silent_mutation Average:27.924; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217008330 NA 3.86E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 5.33E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 1.50E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 3.62E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 2.83E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 5.61E-06 mr1314 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 6.66E-08 mr1450 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 3.04E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 2.84E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 1.42E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 1.79E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 1.85E-07 1.85E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 7.62E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 7.24E-09 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 1.67E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 2.86E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 2.63E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217008330 NA 1.85E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251