| Variant ID: vg1217002530 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17002530 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACGAGATGAACAACAAGTACAGTACTAACTAGGGCACGTACCACACCAACTCTGCAATTATTATCAAGATTGAAGGGACAAATGGAATCGCGGATCTCTA[C/T]
TTTGAAAGAACCATGTAAAAATGTCGGAGTCGGAAAATACCTACTAACATATGGAGTCTTTTTTTTTTGAGAGAGAAACTTATATGGAGTCTCATAGTAG
CTACTATGAGACTCCATATAAGTTTCTCTCTCAAAAAAAAAAGACTCCATATGTTAGTAGGTATTTTCCGACTCCGACATTTTTACATGGTTCTTTCAAA[G/A]
TAGAGATCCGCGATTCCATTTGTCCCTTCAATCTTGATAATAATTGCAGAGTTGGTGTGGTACGTGCCCTAGTTAGTACTGTACTTGTTGTTCATCTCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.80% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 80.90% | 18.80% | 0.33% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 82.70% | 17.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.00% | 37.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217002530 | C -> T | LOC_Os12g28760.1 | downstream_gene_variant ; 2693.0bp to feature; MODIFIER | silent_mutation | Average:54.262; most accessible tissue: Callus, score: 69.21 | N | N | N | N |
| vg1217002530 | C -> T | LOC_Os12g28760-LOC_Os12g28770 | intergenic_region ; MODIFIER | silent_mutation | Average:54.262; most accessible tissue: Callus, score: 69.21 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217002530 | 6.24E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217002530 | NA | 9.44E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217002530 | NA | 5.81E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217002530 | 4.33E-06 | NA | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217002530 | NA | 8.78E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217002530 | NA | 3.62E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217002530 | NA | 1.37E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217002530 | 7.22E-09 | NA | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217002530 | NA | 2.17E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |