\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217002530:

Variant ID: vg1217002530 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17002530
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGAGATGAACAACAAGTACAGTACTAACTAGGGCACGTACCACACCAACTCTGCAATTATTATCAAGATTGAAGGGACAAATGGAATCGCGGATCTCTA[C/T]
TTTGAAAGAACCATGTAAAAATGTCGGAGTCGGAAAATACCTACTAACATATGGAGTCTTTTTTTTTTGAGAGAGAAACTTATATGGAGTCTCATAGTAG

Reverse complement sequence

CTACTATGAGACTCCATATAAGTTTCTCTCTCAAAAAAAAAAGACTCCATATGTTAGTAGGTATTTTCCGACTCCGACATTTTTACATGGTTCTTTCAAA[G/A]
TAGAGATCCGCGATTCCATTTGTCCCTTCAATCTTGATAATAATTGCAGAGTTGGTGTGGTACGTGCCCTAGTTAGTACTGTACTTGTTGTTCATCTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.80% 0.13% 0.00% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 80.90% 18.80% 0.33% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 82.70% 17.10% 0.26% 0.00% NA
Tropical Japonica  504 87.70% 12.30% 0.00% 0.00% NA
Japonica Intermediate  241 61.00% 37.80% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217002530 C -> T LOC_Os12g28760.1 downstream_gene_variant ; 2693.0bp to feature; MODIFIER silent_mutation Average:54.262; most accessible tissue: Callus, score: 69.21 N N N N
vg1217002530 C -> T LOC_Os12g28760-LOC_Os12g28770 intergenic_region ; MODIFIER silent_mutation Average:54.262; most accessible tissue: Callus, score: 69.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217002530 6.24E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217002530 NA 9.44E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217002530 NA 5.81E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217002530 4.33E-06 NA mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217002530 NA 8.78E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217002530 NA 3.62E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217002530 NA 1.37E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217002530 7.22E-09 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217002530 NA 2.17E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251