\
| Variant ID: vg1216994915 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16994915 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTTCCACAACCAATGTAGGACTATTCAACAATCTCCTCCTTCACACATTGGAATCCCTCAGCCCTTCACCGCACCTTCACCGTATACGGGCCCCACCCA[C/T]
GGTTCATCAGGTATACGGGCCCCGCAGGCACCCACGGTCCATCAGGCCTTCACACACTGTGTTCATCGGGCCAATGTGTCCCTCAGCCCTTCATCGCCCC
GGGGCGATGAAGGGCTGAGGGACACATTGGCCCGATGAACACAGTGTGTGAAGGCCTGATGGACCGTGGGTGCCTGCGGGGCCCGTATACCTGATGAACC[G/A]
TGGGTGGGGCCCGTATACGGTGAAGGTGCGGTGAAGGGCTGAGGGATTCCAATGTGTGAAGGAGGAGATTGTTGAATAGTCCTACATTGGTTGTGGAAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 3.60% | 1.40% | 42.36% | NA |
| All Indica | 2759 | 35.40% | 0.70% | 2.17% | 61.73% | NA |
| All Japonica | 1512 | 89.50% | 9.50% | 0.07% | 0.93% | NA |
| Aus | 269 | 21.60% | 0.00% | 1.12% | 77.32% | NA |
| Indica I | 595 | 24.40% | 0.00% | 3.03% | 72.61% | NA |
| Indica II | 465 | 61.90% | 0.00% | 2.37% | 35.70% | NA |
| Indica III | 913 | 26.10% | 1.60% | 1.53% | 70.76% | NA |
| Indica Intermediate | 786 | 39.10% | 0.40% | 2.16% | 58.40% | NA |
| Temperate Japonica | 767 | 90.70% | 8.60% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 87.70% | 11.30% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 89.20% | 8.70% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 40.60% | 0.00% | 1.04% | 58.33% | NA |
| Intermediate | 90 | 68.90% | 6.70% | 1.11% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216994915 | C -> DEL | N | N | silent_mutation | Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1216994915 | C -> T | LOC_Os12g28760.1 | upstream_gene_variant ; 4416.0bp to feature; MODIFIER | silent_mutation | Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1216994915 | C -> T | LOC_Os12g28750.1 | downstream_gene_variant ; 4048.0bp to feature; MODIFIER | silent_mutation | Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1216994915 | C -> T | LOC_Os12g28750-LOC_Os12g28760 | intergenic_region ; MODIFIER | silent_mutation | Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216994915 | 1.40E-08 | NA | mr1489 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216994915 | 3.64E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216994915 | 6.35E-09 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216994915 | NA | 5.52E-06 | mr1790 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216994915 | NA | 1.28E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216994915 | 2.37E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216994915 | 7.99E-09 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216994915 | 2.02E-11 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |