\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216994915:

Variant ID: vg1216994915 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16994915
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTCCACAACCAATGTAGGACTATTCAACAATCTCCTCCTTCACACATTGGAATCCCTCAGCCCTTCACCGCACCTTCACCGTATACGGGCCCCACCCA[C/T]
GGTTCATCAGGTATACGGGCCCCGCAGGCACCCACGGTCCATCAGGCCTTCACACACTGTGTTCATCGGGCCAATGTGTCCCTCAGCCCTTCATCGCCCC

Reverse complement sequence

GGGGCGATGAAGGGCTGAGGGACACATTGGCCCGATGAACACAGTGTGTGAAGGCCTGATGGACCGTGGGTGCCTGCGGGGCCCGTATACCTGATGAACC[G/A]
TGGGTGGGGCCCGTATACGGTGAAGGTGCGGTGAAGGGCTGAGGGATTCCAATGTGTGAAGGAGGAGATTGTTGAATAGTCCTACATTGGTTGTGGAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 3.60% 1.40% 42.36% NA
All Indica  2759 35.40% 0.70% 2.17% 61.73% NA
All Japonica  1512 89.50% 9.50% 0.07% 0.93% NA
Aus  269 21.60% 0.00% 1.12% 77.32% NA
Indica I  595 24.40% 0.00% 3.03% 72.61% NA
Indica II  465 61.90% 0.00% 2.37% 35.70% NA
Indica III  913 26.10% 1.60% 1.53% 70.76% NA
Indica Intermediate  786 39.10% 0.40% 2.16% 58.40% NA
Temperate Japonica  767 90.70% 8.60% 0.13% 0.52% NA
Tropical Japonica  504 87.70% 11.30% 0.00% 0.99% NA
Japonica Intermediate  241 89.20% 8.70% 0.00% 2.07% NA
VI/Aromatic  96 40.60% 0.00% 1.04% 58.33% NA
Intermediate  90 68.90% 6.70% 1.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216994915 C -> DEL N N silent_mutation Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1216994915 C -> T LOC_Os12g28760.1 upstream_gene_variant ; 4416.0bp to feature; MODIFIER silent_mutation Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1216994915 C -> T LOC_Os12g28750.1 downstream_gene_variant ; 4048.0bp to feature; MODIFIER silent_mutation Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1216994915 C -> T LOC_Os12g28750-LOC_Os12g28760 intergenic_region ; MODIFIER silent_mutation Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216994915 1.40E-08 NA mr1489 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915 3.64E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915 6.35E-09 NA mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915 NA 5.52E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915 NA 1.28E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915 2.37E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915 7.99E-09 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915 2.02E-11 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251