Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216994915:

Variant ID: vg1216994915 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16994915
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTTCCACAACCAATGTAGGACTATTCAACAATCTCCTCCTTCACACATTGGAATCCCTCAGCCCTTCACCGCACCTTCACCGTATACGGGCCCCACCCA[C/T]
GGTTCATCAGGTATACGGGCCCCGCAGGCACCCACGGTCCATCAGGCCTTCACACACTGTGTTCATCGGGCCAATGTGTCCCTCAGCCCTTCATCGCCCC

Reverse complement sequence

GGGGCGATGAAGGGCTGAGGGACACATTGGCCCGATGAACACAGTGTGTGAAGGCCTGATGGACCGTGGGTGCCTGCGGGGCCCGTATACCTGATGAACC[G/A]
TGGGTGGGGCCCGTATACGGTGAAGGTGCGGTGAAGGGCTGAGGGATTCCAATGTGTGAAGGAGGAGATTGTTGAATAGTCCTACATTGGTTGTGGAAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	3.60%	1.40%	42.36%	NA
All Indica	2759	35.40%	0.70%	2.17%	61.73%	NA
All Japonica	1512	89.50%	9.50%	0.07%	0.93%	NA
Aus	269	21.60%	0.00%	1.12%	77.32%	NA
Indica I	595	24.40%	0.00%	3.03%	72.61%	NA
Indica II	465	61.90%	0.00%	2.37%	35.70%	NA
Indica III	913	26.10%	1.60%	1.53%	70.76%	NA
Indica Intermediate	786	39.10%	0.40%	2.16%	58.40%	NA
Temperate Japonica	767	90.70%	8.60%	0.13%	0.52%	NA
Tropical Japonica	504	87.70%	11.30%	0.00%	0.99%	NA
Japonica Intermediate	241	89.20%	8.70%	0.00%	2.07%	NA
VI/Aromatic	96	40.60%	0.00%	1.04%	58.33%	NA
Intermediate	90	68.90%	6.70%	1.11%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216994915	C -> DEL	N	N	silent_mutation	Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg1216994915	C -> T	LOC_Os12g28760.1	upstream_gene_variant ; 4416.0bp to feature; MODIFIER	silent_mutation	Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg1216994915	C -> T	LOC_Os12g28750.1	downstream_gene_variant ; 4048.0bp to feature; MODIFIER	silent_mutation	Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg1216994915	C -> T	LOC_Os12g28750-LOC_Os12g28760	intergenic_region ; MODIFIER	silent_mutation	Average:43.529; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216994915	1.40E-08	NA	mr1489	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915	3.64E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915	6.35E-09	NA	mr1778	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915	NA	5.52E-06	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915	NA	1.28E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915	2.37E-06	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915	7.99E-09	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216994915	2.02E-11	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251