Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216993355:

Variant ID: vg1216993355 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16993355
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTAAACACACCACTACTAGGGCTGTGTTTAGTTCACGCAAAGTTTGGATTTTGGTTGAAATTAGAGATGATGTGACTGAAAATTTGTGTGTGTATGA[C/T,G]
AGGTTGATGTGATGAAAAACTACAGAAGTTTGGATCCAAACTGGATCTAAACACAGCCTAGAGGAGGAGGATCCGGTGCGTAACAGGGGCAGCAGGGCTA

Reverse complement sequence

TAGCCCTGCTGCCCCTGTTACGCACCGGATCCTCCTCCTCTAGGCTGTGTTTAGATCCAGTTTGGATCCAAACTTCTGTAGTTTTTCATCACATCAACCT[G/A,C]
TCATACACACACAAATTTTCAGTCACATCATCTCTAATTTCAACCAAAATCCAAACTTTGCGTGAACTAAACACAGCCCTAGTAGTGGTGTGTTTAAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 13.10% 0.78% 44.24% G: 0.02%
All Indica  2759 24.20% 10.20% 1.01% 64.59% NA
All Japonica  1512 81.10% 17.90% 0.07% 0.99% NA
Aus  269 13.80% 5.90% 1.49% 78.81% NA
Indica I  595 11.40% 9.10% 2.35% 77.14% NA
Indica II  465 46.70% 13.80% 0.86% 38.71% NA
Indica III  913 15.90% 11.20% 0.55% 72.40% NA
Indica Intermediate  786 30.30% 7.80% 0.64% 61.32% NA
Temperate Japonica  767 99.10% 0.30% 0.00% 0.65% NA
Tropical Japonica  504 49.40% 49.60% 0.00% 0.99% NA
Japonica Intermediate  241 90.00% 7.50% 0.41% 2.07% NA
VI/Aromatic  96 3.10% 34.40% 0.00% 61.46% G: 1.04%
Intermediate  90 46.70% 23.30% 4.44% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216993355 C -> DEL N N silent_mutation Average:78.506; most accessible tissue: Minghui63 panicle, score: 97.987 N N N N
vg1216993355 C -> G LOC_Os12g28750.1 downstream_gene_variant ; 2488.0bp to feature; MODIFIER silent_mutation Average:78.506; most accessible tissue: Minghui63 panicle, score: 97.987 N N N N
vg1216993355 C -> G LOC_Os12g28750-LOC_Os12g28760 intergenic_region ; MODIFIER silent_mutation Average:78.506; most accessible tissue: Minghui63 panicle, score: 97.987 N N N N
vg1216993355 C -> T LOC_Os12g28750.1 downstream_gene_variant ; 2488.0bp to feature; MODIFIER silent_mutation Average:78.506; most accessible tissue: Minghui63 panicle, score: 97.987 N N N N
vg1216993355 C -> T LOC_Os12g28750-LOC_Os12g28760 intergenic_region ; MODIFIER silent_mutation Average:78.506; most accessible tissue: Minghui63 panicle, score: 97.987 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216993355 C G 0.03 0.01 -0.01 -0.02 -0.01 0.01
vg1216993355 C T -0.01 -0.03 -0.03 -0.03 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216993355 7.72E-06 2.48E-07 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 5.91E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 7.09E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 2.71E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 3.55E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 2.66E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 4.23E-06 4.22E-06 mr1159 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 6.32E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 5.89E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 6.70E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 8.73E-06 8.72E-06 mr1413 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 2.56E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 5.38E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 1.91E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 2.72E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 5.30E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 5.58E-07 mr1541 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 6.65E-06 NA mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 1.51E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 1.90E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 1.99E-06 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 4.96E-06 mr1792 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 6.73E-06 1.07E-07 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 1.30E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 4.89E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 3.57E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 5.37E-07 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 2.62E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 5.32E-08 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 4.71E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 1.58E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 1.04E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 6.79E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 4.29E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 3.66E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 1.93E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 5.51E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 3.13E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 4.42E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993355 NA 8.60E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251