Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216993003:

Variant ID: vg1216993003 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16993003
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTAATGAATAGGTTTTTTTGTTAGTGCTGAATACACCATAAGGTACTCTATATAATATCCGATGCGGTAAGGCTGTGTTTAGTTCACGCCAAAATTG[G/A]
AAGTTTGGTTGAAATTGAAACGATGTGACGGAAAAGTTAAAAGTTTACTACTATATGTGTAGAAAAGTTTTGATGTGATGGAAAAGTTGGAAATTTGAAG

Reverse complement sequence

CTTCAAATTTCCAACTTTTCCATCACATCAAAACTTTTCTACACATATAGTAGTAAACTTTTAACTTTTCCGTCACATCGTTTCAATTTCAACCAAACTT[C/T]
CAATTTTGGCGTGAACTAAACACAGCCTTACCGCATCGGATATTATATAGAGTACCTTATGGTGTATTCAGCACTAACAAAAAAACCTATTCATTAAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 5.10% 0.42% 43.27% NA
All Indica  2759 33.50% 2.70% 0.69% 63.10% NA
All Japonica  1512 88.60% 10.50% 0.00% 0.93% NA
Aus  269 21.20% 0.40% 0.37% 78.07% NA
Indica I  595 20.70% 3.90% 1.01% 74.45% NA
Indica II  465 62.40% 0.00% 0.86% 36.77% NA
Indica III  913 23.30% 4.10% 0.77% 71.85% NA
Indica Intermediate  786 37.90% 1.90% 0.25% 59.92% NA
Temperate Japonica  767 90.50% 9.00% 0.00% 0.52% NA
Tropical Japonica  504 87.50% 11.50% 0.00% 0.99% NA
Japonica Intermediate  241 84.60% 13.30% 0.00% 2.07% NA
VI/Aromatic  96 38.50% 1.00% 0.00% 60.42% NA
Intermediate  90 68.90% 6.70% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216993003 G -> DEL N N silent_mutation Average:44.358; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg1216993003 G -> A LOC_Os12g28750.1 downstream_gene_variant ; 2136.0bp to feature; MODIFIER silent_mutation Average:44.358; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg1216993003 G -> A LOC_Os12g28750-LOC_Os12g28760 intergenic_region ; MODIFIER silent_mutation Average:44.358; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216993003 G A -0.01 0.0 0.0 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216993003 7.50E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993003 5.61E-08 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993003 4.79E-07 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993003 1.02E-08 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993003 NA 2.20E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993003 NA 3.85E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993003 6.66E-07 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993003 2.39E-10 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993003 3.71E-12 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251