Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216964213:

Variant ID: vg1216964213 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16964213
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATGCCGGAGCACGTCCATGAGGAGGCTAGGTACATCATCAGCAGCCTGGTCCCCATGGCGATGTCCTACTTCAACCCCTACGAGCAGATCACCGTGTC[C/G]
GAGTACGGCGAGGAGCGGTTCCGGCGGAACAAGATGTTCGGCGCCGTCTCCACCTACCTGAGCCGCGTGTGTGCCGGTGGCGCCTGCAAGCTCAAGGCCG

Reverse complement sequence

CGGCCTTGAGCTTGCAGGCGCCACCGGCACACACGCGGCTCAGGTAGGTGGAGACGGCGCCGAACATCTTGTTCCGCCGGAACCGCTCCTCGCCGTACTC[G/C]
GACACGGTGATCTGCTCGTAGGGGTTGAAGTAGGACATCGCCATGGGGACCAGGCTGCTGATGATGTACCTAGCCTCCTCATGGACGTGCTCCGGCATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 4.80% 1.23% 0.59% NA
All Indica  2759 92.40% 7.40% 0.22% 0.04% NA
All Japonica  1512 94.70% 0.10% 3.37% 1.79% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 91.80% 7.90% 0.34% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 89.30% 10.40% 0.22% 0.11% NA
Indica Intermediate  786 94.10% 5.60% 0.25% 0.00% NA
Temperate Japonica  767 98.70% 0.00% 1.30% 0.00% NA
Tropical Japonica  504 88.30% 0.20% 6.15% 5.36% NA
Japonica Intermediate  241 95.40% 0.40% 4.15% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216964213 C -> DEL LOC_Os12g28710.1 N frameshift_variant Average:92.298; most accessible tissue: Zhenshan97 young leaf, score: 98.674 N N N N
vg1216964213 C -> G LOC_Os12g28710.1 synonymous_variant ; p.Ser56Ser; LOW synonymous_codon Average:92.298; most accessible tissue: Zhenshan97 young leaf, score: 98.674 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216964213 C G -0.02 -0.03 -0.04 -0.02 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216964213 2.25E-06 NA mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216964213 4.73E-06 1.78E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251