\
| Variant ID: vg1216914223 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16914223 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, C: 0.45, others allele: 0.00, population size: 55. )
TGCATTGTTCTCTAGCCTGAACATTCCATGTGATATCTTGACCATTTGGACCTCAACTAGCTTCTCCCAAGCCTAGTCTAGATCCATCACTGGCTATACT[A/C]
CCATGGTCTCAAGCAACACCTGCACAAGAACAACAAAGAAACTCTTTATCCGAGTACAAGTTCGTACCAACTTAACTCACATCAACACACAATAGTATCA
TGATACTATTGTGTGTTGATGTGAGTTAAGTTGGTACGAACTTGTACTCGGATAAAGAGTTTCTTTGTTGTTCTTGTGCAGGTGTTGCTTGAGACCATGG[T/G]
AGTATAGCCAGTGATGGATCTAGACTAGGCTTGGGAGAAGCTAGTTGAGGTCCAAATGGTCAAGATATCACATGGAATGTTCAGGCTAGAGAACAATGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.20% | 6.50% | 0.08% | 62.19% | NA |
| All Indica | 2759 | 11.50% | 8.40% | 0.11% | 79.99% | NA |
| All Japonica | 1512 | 71.50% | 2.90% | 0.07% | 25.53% | NA |
| Aus | 269 | 13.40% | 5.90% | 0.00% | 80.67% | NA |
| Indica I | 595 | 24.20% | 8.60% | 0.17% | 67.06% | NA |
| Indica II | 465 | 9.70% | 4.10% | 0.22% | 86.02% | NA |
| Indica III | 913 | 1.80% | 12.40% | 0.00% | 85.87% | NA |
| Indica Intermediate | 786 | 14.10% | 6.40% | 0.13% | 79.39% | NA |
| Temperate Japonica | 767 | 93.70% | 0.10% | 0.00% | 6.13% | NA |
| Tropical Japonica | 504 | 34.50% | 8.30% | 0.00% | 57.14% | NA |
| Japonica Intermediate | 241 | 78.00% | 0.40% | 0.41% | 21.16% | NA |
| VI/Aromatic | 96 | 3.10% | 11.50% | 0.00% | 85.42% | NA |
| Intermediate | 90 | 43.30% | 4.40% | 0.00% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216914223 | A -> C | LOC_Os12g28590.1 | downstream_gene_variant ; 3353.0bp to feature; MODIFIER | silent_mutation | Average:15.497; most accessible tissue: Callus, score: 54.602 | N | N | N | N |
| vg1216914223 | A -> C | LOC_Os12g28600.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.497; most accessible tissue: Callus, score: 54.602 | N | N | N | N |
| vg1216914223 | A -> DEL | N | N | silent_mutation | Average:15.497; most accessible tissue: Callus, score: 54.602 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216914223 | NA | 4.95E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216914223 | 5.11E-06 | NA | mr1686 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216914223 | NA | 6.73E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216914223 | NA | 4.53E-08 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216914223 | NA | 3.23E-06 | mr1483_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |