\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216905020:

Variant ID: vg1216905020 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16905020
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TATATCGCGATGTTTGTTTCCTATGATTGGTTTCTGTTTTTTTGGCAATTTTTAAGGAAGAGCGATCTTTGTCTCCAAGCGTAAGAATATGTGCAGTAGG[C/T]
CAGCAGCTTCCGTGCTCGGGTTGCCAAACCTCAGCTGCCGTCAGCGTTGCATCTTGAGGATGACTCAGCCACTGTGGCTGATCGATTAGGGAAGGAGATT

Reverse complement sequence

AATCTCCTTCCCTAATCGATCAGCCACAGTGGCTGAGTCATCCTCAAGATGCAACGCTGACGGCAGCTGAGGTTTGGCAACCCGAGCACGGAAGCTGCTG[G/A]
CCTACTGCACATATTCTTACGCTTGGAGACAAAGATCGCTCTTCCTTAAAAATTGCCAAAAAAACAGAAACCAATCATAGGAAACAAACATCGCGATATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.20% 41.10% 0.61% 15.11% NA
All Indica  2759 55.00% 30.30% 0.72% 13.95% NA
All Japonica  1512 20.60% 68.10% 0.20% 11.11% NA
Aus  269 51.70% 8.90% 1.49% 37.92% NA
Indica I  595 65.50% 31.40% 1.18% 1.85% NA
Indica II  465 29.00% 44.90% 1.94% 24.09% NA
Indica III  913 64.70% 21.90% 0.22% 13.14% NA
Indica Intermediate  786 51.00% 30.70% 0.25% 18.07% NA
Temperate Japonica  767 4.30% 90.20% 0.00% 5.48% NA
Tropical Japonica  504 48.40% 44.40% 0.00% 7.14% NA
Japonica Intermediate  241 14.10% 47.30% 1.24% 37.34% NA
VI/Aromatic  96 33.30% 11.50% 0.00% 55.21% NA
Intermediate  90 45.60% 45.60% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216905020 C -> DEL N N silent_mutation Average:83.243; most accessible tissue: Zhenshan97 root, score: 96.409 N N N N
vg1216905020 C -> T LOC_Os12g28590.1 upstream_gene_variant ; 3996.0bp to feature; MODIFIER silent_mutation Average:83.243; most accessible tissue: Zhenshan97 root, score: 96.409 N N N N
vg1216905020 C -> T LOC_Os12g28580-LOC_Os12g28590 intergenic_region ; MODIFIER silent_mutation Average:83.243; most accessible tissue: Zhenshan97 root, score: 96.409 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216905020 C T 0.11 0.0 -0.03 -0.05 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216905020 NA 5.62E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216905020 NA 4.82E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216905020 NA 4.55E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216905020 NA 6.57E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216905020 3.80E-06 NA mr1183 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216905020 NA 2.20E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251