Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216901611:

Variant ID: vg1216901611 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16901611
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATCAATAAGAAAAAAAACATACGTACTTAGTACCATGCGAAAAAATTGATGATATTTAAAATAAGATTTTCTATTATTTAAAGATAAAGTTCATTAAA[T/C]
TTCCTATAAACGCTCTCAAGCCGCCACGTGAGACTCCTAGAAACGCTCATAGGCCGCCACGTGGCTCTATCTAATCTAACCGTCGATTTTCACTTAAATT

Reverse complement sequence

AATTTAAGTGAAAATCGACGGTTAGATTAGATAGAGCCACGTGGCGGCCTATGAGCGTTTCTAGGAGTCTCACGTGGCGGCTTGAGAGCGTTTATAGGAA[A/G]
TTTAATGAACTTTATCTTTAAATAATAGAAAATCTTATTTTAAATATCATCAATTTTTTCGCATGGTACTAAGTACGTATGTTTTTTTTCTTATTGATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.00%	0.70%	12.40%	41.87%	NA
All Indica	2759	38.70%	1.00%	11.42%	48.86%	NA
All Japonica	1512	62.20%	0.10%	8.73%	28.97%	NA
Aus	269	19.00%	0.00%	35.69%	45.35%	NA
Indica I	595	42.70%	0.30%	7.06%	49.92%	NA
Indica II	465	25.40%	0.40%	8.82%	65.38%	NA
Indica III	913	46.00%	1.60%	15.33%	37.02%	NA
Indica Intermediate	786	35.10%	1.10%	11.70%	52.04%	NA
Temperate Japonica	767	89.00%	0.10%	0.65%	10.17%	NA
Tropical Japonica	504	29.80%	0.20%	22.22%	47.82%	NA
Japonica Intermediate	241	44.40%	0.00%	6.22%	49.38%	NA
VI/Aromatic	96	22.90%	1.00%	32.29%	43.75%	NA
Intermediate	90	53.30%	1.10%	13.33%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216901611	T -> C	LOC_Os12g28580-LOC_Os12g28590	intergenic_region ; MODIFIER	silent_mutation	Average:15.758; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N
vg1216901611	T -> DEL	N	N	silent_mutation	Average:15.758; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216901611	NA	8.74E-06	mr1363	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216901611	1.21E-06	3.90E-07	mr1413	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251