\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216898802:

Variant ID: vg1216898802 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16898802
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.41, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCGAGTCATGTAGGGCAGGGCAGCTAGAGATATCGTATCCTTGTGAGTTAGAGTTACTATGAGGCTCCTGGCTCAGATGGCATATCGGTCCAAGTGCG[G/A]
GATGCTACCTCTAAGTTTTTTTTTTTCATATTCGTCCCTGAAAAATTATATATTTTTTTAATTGAGGTATATTCCTCTCTGGTACTACCTCCGTTTCGAA

Reverse complement sequence

TTCGAAACGGAGGTAGTACCAGAGAGGAATATACCTCAATTAAAAAAATATATAATTTTTCAGGGACGAATATGAAAAAAAAAAACTTAGAGGTAGCATC[C/T]
CGCACTTGGACCGATATGCCATCTGAGCCAGGAGCCTCATAGTAACTCTAACTCACAAGGATACGATATCTCTAGCTGCCCTGCCCTACATGACTCGGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.80% 21.80% 9.25% 40.22% NA
All Indica  2759 30.00% 8.10% 14.53% 47.30% NA
All Japonica  1512 20.80% 50.70% 1.46% 27.05% NA
Aus  269 56.50% 3.00% 0.37% 40.15% NA
Indica I  595 27.20% 19.80% 25.71% 27.23% NA
Indica II  465 19.60% 5.40% 7.74% 67.31% NA
Indica III  913 39.80% 0.50% 11.72% 47.97% NA
Indica Intermediate  786 27.10% 9.70% 13.36% 49.87% NA
Temperate Japonica  767 3.90% 85.10% 0.52% 10.43% NA
Tropical Japonica  504 52.60% 5.80% 2.98% 38.69% NA
Japonica Intermediate  241 7.90% 35.30% 1.24% 55.60% NA
VI/Aromatic  96 38.50% 0.00% 2.08% 59.38% NA
Intermediate  90 31.10% 32.20% 12.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216898802 G -> DEL N N silent_mutation Average:81.501; most accessible tissue: Minghui63 root, score: 98.115 N N N N
vg1216898802 G -> A LOC_Os12g28580-LOC_Os12g28590 intergenic_region ; MODIFIER silent_mutation Average:81.501; most accessible tissue: Minghui63 root, score: 98.115 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216898802 G A -0.04 -0.02 -0.02 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216898802 NA 6.21E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 5.14E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 2.00E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 5.94E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 1.03E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 3.90E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 5.08E-20 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 1.56E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 2.89E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 3.20E-06 3.20E-06 mr1474 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 3.20E-06 3.20E-06 mr1475 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 9.01E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 7.93E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 3.80E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 4.43E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 1.74E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 1.87E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 3.36E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898802 NA 5.62E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251