\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216898780:

Variant ID: vg1216898780 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16898780
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGCGTGTGAATGGCTTGATAGGCCGAGTCATGTAGGGCAGGGCAGCTAGAGATATCGTATCCTTGTGAGTTAGAGTTACTATGAGGCTCCTGGCTCAG[A/G]
TGGCATATCGGTCCAAGTGCGGGATGCTACCTCTAAGTTTTTTTTTTTCATATTCGTCCCTGAAAAATTATATATTTTTTTAATTGAGGTATATTCCTCT

Reverse complement sequence

AGAGGAATATACCTCAATTAAAAAAATATATAATTTTTCAGGGACGAATATGAAAAAAAAAAACTTAGAGGTAGCATCCCGCACTTGGACCGATATGCCA[T/C]
CTGAGCCAGGAGCCTCATAGTAACTCTAACTCACAAGGATACGATATCTCTAGCTGCCCTGCCCTACATGACTCGGCCTATCAAGCCATTCACACGCTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 29.00% 2.37% 31.29% NA
All Indica  2759 46.30% 17.50% 3.19% 32.98% NA
All Japonica  1512 19.00% 54.30% 0.93% 25.79% NA
Aus  269 51.30% 8.60% 0.37% 39.78% NA
Indica I  595 57.60% 29.90% 3.19% 9.24% NA
Indica II  465 22.80% 9.90% 4.95% 62.37% NA
Indica III  913 53.80% 13.30% 2.41% 30.56% NA
Indica Intermediate  786 43.00% 17.60% 3.05% 36.39% NA
Temperate Japonica  767 4.00% 85.70% 0.26% 10.04% NA
Tropical Japonica  504 44.60% 15.10% 1.98% 38.29% NA
Japonica Intermediate  241 12.90% 36.50% 0.83% 49.79% NA
VI/Aromatic  96 29.20% 11.50% 1.04% 58.33% NA
Intermediate  90 35.60% 37.80% 8.89% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216898780 A -> DEL N N silent_mutation Average:81.554; most accessible tissue: Minghui63 root, score: 98.122 N N N N
vg1216898780 A -> G LOC_Os12g28580-LOC_Os12g28590 intergenic_region ; MODIFIER silent_mutation Average:81.554; most accessible tissue: Minghui63 root, score: 98.122 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216898780 A G -0.02 -0.01 0.0 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216898780 NA 3.56E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1216898780 NA 1.09E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1216898780 NA 3.65E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898780 8.70E-06 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216898780 5.38E-07 NA mr1458_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251