\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216893924:

Variant ID: vg1216893924 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16893924
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTCAATTGCTTCTTCCATGAGAAAAGGGGAAACTTGATCGATTTCAAAGCAACCTAATGGTGGAAGTTTGATTCAGTGAGCCATTCATGAGAAGTAGA[G/A]
GGCATAAGAGAGAGTTCAAGCTTTGAAGTGCAGAAAAGCTCCTGTCCAGCGATCACCTCCTCCACTCATGCCAAAACATCAACAAGATTGTTCCATCTGG

Reverse complement sequence

CCAGATGGAACAATCTTGTTGATGTTTTGGCATGAGTGGAGGAGGTGATCGCTGGACAGGAGCTTTTCTGCACTTCAAAGCTTGAACTCTCTCTTATGCC[C/T]
TCTACTTCTCATGAATGGCTCACTGAATCAAACTTCCACCATTAGGTTGCTTTGAAATCGATCAAGTTTCCCCTTTTCTCATGGAAGAAGCAATTGAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.50% 19.20% 1.31% 50.02% NA
All Indica  2759 17.80% 28.70% 1.41% 52.05% NA
All Japonica  1512 54.50% 6.60% 1.06% 37.83% NA
Aus  269 9.70% 1.10% 0.74% 88.48% NA
Indica I  595 31.80% 5.40% 1.18% 61.68% NA
Indica II  465 9.90% 64.50% 0.86% 24.73% NA
Indica III  913 13.10% 22.30% 1.20% 63.31% NA
Indica Intermediate  786 17.40% 32.60% 2.16% 47.84% NA
Temperate Japonica  767 85.90% 2.70% 0.65% 10.69% NA
Tropical Japonica  504 15.10% 12.30% 1.19% 71.43% NA
Japonica Intermediate  241 36.90% 7.10% 2.07% 53.94% NA
VI/Aromatic  96 12.50% 2.10% 3.12% 82.29% NA
Intermediate  90 42.20% 12.20% 2.22% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216893924 G -> DEL N N silent_mutation Average:10.053; most accessible tissue: Callus, score: 49.289 N N N N
vg1216893924 G -> A LOC_Os12g28580.1 upstream_gene_variant ; 291.0bp to feature; MODIFIER silent_mutation Average:10.053; most accessible tissue: Callus, score: 49.289 N N N N
vg1216893924 G -> A LOC_Os12g28580-LOC_Os12g28590 intergenic_region ; MODIFIER silent_mutation Average:10.053; most accessible tissue: Callus, score: 49.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216893924 NA 4.14E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 3.25E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 2.28E-07 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 5.94E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 6.29E-06 1.35E-13 mr1031 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 2.19E-08 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 3.07E-06 3.14E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 1.08E-08 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 1.75E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 2.30E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 4.31E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 6.43E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 8.51E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 1.83E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 3.09E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 9.97E-13 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 7.67E-07 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 1.79E-07 mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 2.46E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 8.26E-06 7.71E-11 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 1.29E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 2.30E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 1.60E-15 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 3.16E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 1.74E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924 NA 2.04E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251