Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216893924:

Variant ID: vg1216893924 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16893924
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

GCCTCAATTGCTTCTTCCATGAGAAAAGGGGAAACTTGATCGATTTCAAAGCAACCTAATGGTGGAAGTTTGATTCAGTGAGCCATTCATGAGAAGTAGA[G/A]
GGCATAAGAGAGAGTTCAAGCTTTGAAGTGCAGAAAAGCTCCTGTCCAGCGATCACCTCCTCCACTCATGCCAAAACATCAACAAGATTGTTCCATCTGG

Reverse complement sequence

CCAGATGGAACAATCTTGTTGATGTTTTGGCATGAGTGGAGGAGGTGATCGCTGGACAGGAGCTTTTCTGCACTTCAAAGCTTGAACTCTCTCTTATGCC[C/T]
TCTACTTCTCATGAATGGCTCACTGAATCAAACTTCCACCATTAGGTTGCTTTGAAATCGATCAAGTTTCCCCTTTTCTCATGGAAGAAGCAATTGAGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.50%	19.20%	1.31%	50.02%	NA
All Indica	2759	17.80%	28.70%	1.41%	52.05%	NA
All Japonica	1512	54.50%	6.60%	1.06%	37.83%	NA
Aus	269	9.70%	1.10%	0.74%	88.48%	NA
Indica I	595	31.80%	5.40%	1.18%	61.68%	NA
Indica II	465	9.90%	64.50%	0.86%	24.73%	NA
Indica III	913	13.10%	22.30%	1.20%	63.31%	NA
Indica Intermediate	786	17.40%	32.60%	2.16%	47.84%	NA
Temperate Japonica	767	85.90%	2.70%	0.65%	10.69%	NA
Tropical Japonica	504	15.10%	12.30%	1.19%	71.43%	NA
Japonica Intermediate	241	36.90%	7.10%	2.07%	53.94%	NA
VI/Aromatic	96	12.50%	2.10%	3.12%	82.29%	NA
Intermediate	90	42.20%	12.20%	2.22%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216893924	G -> DEL	N	N	silent_mutation	Average:10.053; most accessible tissue: Callus, score: 49.289	N	N	N	N
vg1216893924	G -> A	LOC_Os12g28580.1	upstream_gene_variant ; 291.0bp to feature; MODIFIER	silent_mutation	Average:10.053; most accessible tissue: Callus, score: 49.289	N	N	N	N
vg1216893924	G -> A	LOC_Os12g28580-LOC_Os12g28590	intergenic_region ; MODIFIER	silent_mutation	Average:10.053; most accessible tissue: Callus, score: 49.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216893924	NA	4.14E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	3.25E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	2.28E-07	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	5.94E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	6.29E-06	1.35E-13	mr1031	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	2.19E-08	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	3.07E-06	3.14E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	1.08E-08	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	1.75E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	2.30E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	4.31E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	6.43E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	8.51E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	1.83E-11	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	3.09E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	9.97E-13	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	7.67E-07	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	1.79E-07	mr1965	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	2.46E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	8.26E-06	7.71E-11	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	1.29E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	2.30E-15	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	1.60E-15	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	3.16E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	1.74E-15	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893924	NA	2.04E-15	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251