Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216893818:

Variant ID: vg1216893818 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16893818
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.16, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

ATTACATATTGGCACACATATTCTTAGAGAACATTCATGGCCTTGTAGTTGTATTACACACCTATGTGCTTCCATCGCTGGACTATTTGACATAGTTTGA[T/C]
GGCAAGCCTCAATTGCTTCTTCCATGAGAAAAGGGGAAACTTGATCGATTTCAAAGCAACCTAATGGTGGAAGTTTGATTCAGTGAGCCATTCATGAGAA

Reverse complement sequence

TTCTCATGAATGGCTCACTGAATCAAACTTCCACCATTAGGTTGCTTTGAAATCGATCAAGTTTCCCCTTTTCTCATGGAAGAAGCAATTGAGGCTTGCC[A/G]
TCAAACTATGTCAAATAGTCCAGCGATGGAAGCACATAGGTGTGTAATACAACTACAAGGCCATGAATGTTCTCTAAGAATATGTGTGCCAATATGTAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.50%	19.10%	1.08%	50.36%	NA
All Indica	2759	17.90%	28.40%	1.27%	52.37%	NA
All Japonica	1512	54.60%	6.70%	0.73%	37.96%	NA
Aus	269	9.30%	1.10%	0.00%	89.59%	NA
Indica I	595	31.40%	4.70%	1.51%	62.35%	NA
Indica II	465	10.10%	64.30%	1.08%	24.52%	NA
Indica III	913	13.40%	22.00%	1.20%	63.42%	NA
Indica Intermediate	786	17.70%	32.60%	1.27%	48.47%	NA
Temperate Japonica	767	85.70%	2.90%	0.65%	10.82%	NA
Tropical Japonica	504	15.50%	12.30%	1.19%	71.03%	NA
Japonica Intermediate	241	37.80%	7.10%	0.00%	55.19%	NA
VI/Aromatic	96	11.50%	2.10%	4.17%	82.29%	NA
Intermediate	90	41.10%	12.20%	1.11%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216893818	T -> C	LOC_Os12g28580.1	upstream_gene_variant ; 185.0bp to feature; MODIFIER	silent_mutation	Average:12.413; most accessible tissue: Callus, score: 76.622	N	N	N	N
vg1216893818	T -> C	LOC_Os12g28580-LOC_Os12g28590	intergenic_region ; MODIFIER	silent_mutation	Average:12.413; most accessible tissue: Callus, score: 76.622	N	N	N	N
vg1216893818	T -> DEL	N	N	silent_mutation	Average:12.413; most accessible tissue: Callus, score: 76.622	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216893818	NA	5.85E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	4.02E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	1.09E-07	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	1.19E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	8.43E-06	7.71E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	1.90E-08	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	2.11E-06	7.82E-15	mr1056	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	5.14E-09	mr1056	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	2.19E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	1.88E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	3.60E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	4.75E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	2.17E-11	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	9.90E-07	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	1.19E-12	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	2.91E-07	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	5.78E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	6.20E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	2.34E-08	mr1965	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	6.60E-07	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	8.49E-11	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	1.43E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	2.83E-15	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	1.96E-15	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	3.78E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	2.07E-15	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893818	NA	2.35E-15	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251