Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216893626:

Variant ID: vg1216893626 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16893626
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.07, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCTTTCTGTCCACAGTAGCTAAGCCAAAATGCCCAAGCCACATCTGAATTTGTAAATTCCATGCCAACTTGAGGTACCAAACTAGGCATCAAGTTAT[T/C]
TCTGTATTGAAAAAAAAAAACACTACTGAGTATGAAACTAGTGCATAGATATGCTAACAAAAAAATCGCCAAAACCATGCTGTAAACATTGATTACATAT

Reverse complement sequence

ATATGTAATCAATGTTTACAGCATGGTTTTGGCGATTTTTTTGTTAGCATATCTATGCACTAGTTTCATACTCAGTAGTGTTTTTTTTTTTCAATACAGA[A/G]
ATAACTTGATGCCTAGTTTGGTACCTCAAGTTGGCATGGAATTTACAAATTCAGATGTGGCTTGGGCATTTTGGCTTAGCTACTGTGGACAGAAAGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.20%	19.20%	0.87%	50.78%	NA
All Indica	2759	17.60%	28.60%	0.94%	52.85%	NA
All Japonica	1512	54.30%	6.70%	0.66%	38.36%	NA
Aus	269	9.30%	1.10%	0.00%	89.59%	NA
Indica I	595	30.90%	4.90%	1.34%	62.86%	NA
Indica II	465	9.70%	64.70%	0.86%	24.73%	NA
Indica III	913	13.10%	22.20%	0.55%	64.07%	NA
Indica Intermediate	786	17.40%	32.60%	1.15%	48.85%	NA
Temperate Japonica	767	85.70%	2.90%	0.13%	11.34%	NA
Tropical Japonica	504	15.10%	12.30%	1.39%	71.23%	NA
Japonica Intermediate	241	36.50%	7.10%	0.83%	55.60%	NA
VI/Aromatic	96	11.50%	2.10%	2.08%	84.38%	NA
Intermediate	90	40.00%	12.20%	3.33%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216893626	T -> C	LOC_Os12g28580.1	5_prime_UTR_variant ; 9.0bp to feature; MODIFIER	silent_mutation	Average:10.808; most accessible tissue: Callus, score: 57.6	N	N	N	N
vg1216893626	T -> DEL	N	N	silent_mutation	Average:10.808; most accessible tissue: Callus, score: 57.6	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216893626	NA	1.81E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	6.71E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	6.34E-06	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	2.29E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	4.17E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	1.92E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	6.12E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	2.45E-06	2.45E-06	mr1421	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	5.68E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	2.63E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	5.01E-06	mr1754	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	1.33E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	2.56E-10	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	4.60E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	3.32E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	8.92E-14	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	8.22E-14	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	1.08E-13	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	9.18E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626	NA	1.03E-06	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251