\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216893626:

Variant ID: vg1216893626 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16893626
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.07, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCTTTCTGTCCACAGTAGCTAAGCCAAAATGCCCAAGCCACATCTGAATTTGTAAATTCCATGCCAACTTGAGGTACCAAACTAGGCATCAAGTTAT[T/C]
TCTGTATTGAAAAAAAAAAACACTACTGAGTATGAAACTAGTGCATAGATATGCTAACAAAAAAATCGCCAAAACCATGCTGTAAACATTGATTACATAT

Reverse complement sequence

ATATGTAATCAATGTTTACAGCATGGTTTTGGCGATTTTTTTGTTAGCATATCTATGCACTAGTTTCATACTCAGTAGTGTTTTTTTTTTTCAATACAGA[A/G]
ATAACTTGATGCCTAGTTTGGTACCTCAAGTTGGCATGGAATTTACAAATTCAGATGTGGCTTGGGCATTTTGGCTTAGCTACTGTGGACAGAAAGGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 19.20% 0.87% 50.78% NA
All Indica  2759 17.60% 28.60% 0.94% 52.85% NA
All Japonica  1512 54.30% 6.70% 0.66% 38.36% NA
Aus  269 9.30% 1.10% 0.00% 89.59% NA
Indica I  595 30.90% 4.90% 1.34% 62.86% NA
Indica II  465 9.70% 64.70% 0.86% 24.73% NA
Indica III  913 13.10% 22.20% 0.55% 64.07% NA
Indica Intermediate  786 17.40% 32.60% 1.15% 48.85% NA
Temperate Japonica  767 85.70% 2.90% 0.13% 11.34% NA
Tropical Japonica  504 15.10% 12.30% 1.39% 71.23% NA
Japonica Intermediate  241 36.50% 7.10% 0.83% 55.60% NA
VI/Aromatic  96 11.50% 2.10% 2.08% 84.38% NA
Intermediate  90 40.00% 12.20% 3.33% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216893626 T -> C LOC_Os12g28580.1 5_prime_UTR_variant ; 9.0bp to feature; MODIFIER silent_mutation Average:10.808; most accessible tissue: Callus, score: 57.6 N N N N
vg1216893626 T -> DEL N N silent_mutation Average:10.808; most accessible tissue: Callus, score: 57.6 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216893626 NA 1.81E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 6.71E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 6.34E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 2.29E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 4.17E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 1.92E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 6.12E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 2.45E-06 2.45E-06 mr1421 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 5.68E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 2.63E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 5.01E-06 mr1754 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 1.33E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 2.56E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 4.60E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 3.32E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 8.92E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 8.22E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 1.08E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 9.18E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216893626 NA 1.03E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251